1110065P20Rik (NM_001142727) Mouse Untagged Clone

CAT#: MC210820

1110065P20Rik (untagged) - Mouse RIKEN cDNA 1110065P20 gene (1110065P20Rik), (10ug)


  "NM_001142727" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "1110065P20Rik"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol 1110065P20Rik
Synonyms C530005M16Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210820 representing NM_001142727
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCGGCAGCTGGGCCGCCGGCGCCCAGAACCGGCTGGTGGCGGGAACGGTTCAGCCAAGTCTGGAG
CGCCGCCCCAGCCATCTGTATCGGCCAGAGGTGGCCTTCCAAAGGATGCTGGCGATGGAGCCTCGGAGTC
TTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001142727
ORF Size 144 bp
Insert Size 144
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001142727.1, NP_001136199.1
RefSeq Size 785
RefSeq ORF 144
Locus ID 68920

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.