Fndc5 (NM_027402) Mouse Untagged Clone

CAT#: MC214786

Fndc5 (untagged) - Mouse fibronectin type III domain containing 5 (Fndc5), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fndc5
• Synonyms: 1500001L03Rik; AI836596; C87088; PeP; Pxp
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214786 representing NM_027402
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCCCAGGGCCGTGCGCCTGGCCGCCCCGCGCCGCGCTCCGCCTGTGGCTAGGCTGCGTCTGCTTCG
  CGCTGGTGCAGGCGGACAGCCCCTCAGCCCCTGTGAACGTGACCGTCCGGCACCTCAAGGCCAACTCTGC
  CGTGGTCAGCTGGGATGTCCTGGAGGATGAAGTGGTCATTGGCTTTGCCATCTCTCAGCAGAAGAAGGAT
  GTGCGGATGCTCCGGTTCATTCAGGAGGTGAACACCACCACCCGGTCCTGCGCTCTCTGGGACCTGGAGG
  AGGACACAGAATATATCGTCCATGTGCAGGCCATCTCCATCCAGGGACAGAGCCCAGCCAGTGAGCCTGT
  GCTCTTCAAGACCCCGCGCGAGGCTGAAAAGATGGCCTCAAAGAACAAAGATGAGGTGACCATGAAGGAG
  ATGGGGAGGAACCAGCAGCTGCGAACGGGGGAGGTGCTGATCATTGTTGTGGTCCTCTTCATGTGGGCAG
  GTGTTATAGCTCTCTTCTGCCGCCAGTATGATATCATCAAGGACAACGAGCCCAATAACAACAAGGAGAA
  AACCAAGAGCGCATCAGAAACCAGCACACCGGAGCATCAGGGTGGGGGTCTCCTCCGCAGCAAGATATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027402
• ORF Size: 630 bp
• Insert Size: 630
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC109184, AAI09185
• RefSeq Size: 725
• RefSeq ORF: 630
• Locus ID: 384061
• Gene Summary: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]