Tmsb15l (NM_207267) Mouse Untagged Clone

CAT#: MC214850

Tmsb15l (untagged) - Mouse thymosin beta 15b like (Tmsb15l), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tmsb15l
• Synonyms: 4930488E11Rik; Tb15r; Tmsb15b1-Tmsb15b2; Tmsb15r
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214850 representing NM_207267
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCGATAAACCAGACTTGTCAGAAGTTGAAACGTTTGACAAATCAAAGTTGAAGAAAACTAATACTG
  AAGTAAAAAATACTCTTCCGTCGAATGAAAACAAGATGAGCGATAAACCAGACTTGTCAGAAGTTGAAAC
  ATTTGACAAAGCAAAGTTGAAGAAAACTAATACTGAAGTAAAAAATACTCTTCCGTCGAAGGAAACTATC
  CAGCAAGAGAAAGAACACAATGAAAGAACATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_207267
• ORF Size: 243 bp
• Insert Size: 243
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_207267.4, NP_997150.1
• RefSeq Size: 821
• RefSeq ORF: 243
• Locus ID: 399591
• Gene Summary: This record represents readthrough transcripts derived from two adjacent genes, represented by GeneIDs 100034363 and 666244. Each gene has three exons. The readthrough transcripts include two exons from each gene, such that the second exon is represented twice, although not identically, in the readthrough transcripts. [provided by RefSeq, Jul 2008]