Gpx4 (NM_008162) Mouse Untagged Clone

CAT#: MC215241

Gpx4 (untagged) - Mouse glutathione peroxidase 4 (Gpx4), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)


  "NM_008162" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Gpx4"

Specifications

Product Data
Type Mouse Untagged Clone
Symbol Gpx4
Synonyms GPx-4; GSHPx-4; mtPHGPx; PHGPx; snGPx
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215241 representing NM_008162
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCTGGGGCCGTCTGAGCCGCTTACTTAAGCCAGCACTGCTGTGCGGGGCTCTGGCTGCGCCTGGTC
TGGCAGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCTCAGCCAA
GGACATCGACGGGCACATGGTCTGCCTGGATAAGTACAGGGGTTTCGTGTGCATCGTCACCAACGTGGCC
TCGCAATGAGGCAAAACTGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATATGCTGAGTGTG
GTTTACGAATCCTGGCCTTCCCCTGCAACCAGTTTGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAA
GGAGTTTGCAGCCGGCTACAACGTCAAGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCC
CACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGA
ACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCA
GGTGATAGAGAAGGACCTGCCGTGCTATCTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008162
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Reference Data
RefSeq NM_008162.3, NP_032188.3
RefSeq Size 974
RefSeq ORF 594
Locus ID 625249
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Disruption of this gene in mouse spermatocytes is associated with male infertility. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. Pseudogenes of this locus have been identified on chromosomes 10 and 17. [provided by RefSeq, Jan 2019]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the canonical isoform A (also known as phGPx). A similar isoform in rat(L-form) has been shown to be localized to the mitochondria (PMID:9988735).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.