Gimap4 (NM_001243201) Mouse Untagged Clone

CAT#: MC225485

Gimap4 (untagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 5


  "NM_001243201" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Gimap4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gimap4
Synonyms AU019574; E430007K16Rik; Ian-1; Ian1; Imap4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225485 representing NM_001243201
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGTCCAGTGCGGTGGTGCGGGGTTCATCCCAGAAAGTTCAAGGAGCAGCCATGAGCTTGGAAACC
AAGATCAAGGAATTCCCCAACTGAGAATTGTCTTACTTGGAAAAACTGGAGCAGGAAAGAGTTCAACAGG
GAACATGCTCACCCCCCCCGATGCCCAAATGCTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001243201
ORF Size 177 bp
Insert Size 177
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001243201.1, NP_001230130.1
RefSeq Size 906
RefSeq ORF 177
Locus ID 107526
Gene Summary This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (5) lacks an alternate segment that spans both the central and 3' coding regions, and which results in a frameshift, compared to variant 1. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.