Gimap4 (NM_001243201) Mouse Untagged Clone
CAT#: MC225485
Gimap4 (untagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 5
"NM_001243201" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Gimap4 |
Synonyms | AU019574; E430007K16Rik; Ian-1; Ian1; Imap4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225485 representing NM_001243201
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGTCCAGTGCGGTGGTGCGGGGTTCATCCCAGAAAGTTCAAGGAGCAGCCATGAGCTTGGAAACC AAGATCAAGGAATTCCCCAACTGAGAATTGTCTTACTTGGAAAAACTGGAGCAGGAAAGAGTTCAACAGG GAACATGCTCACCCCCCCCGATGCCCAAATGCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243201 |
ORF Size | 177 bp |
Insert Size | 177 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK. |
Reference Data | |
RefSeq | NM_001243201.1, NP_001230130.1 |
RefSeq Size | 906 |
RefSeq ORF | 177 |
Locus ID | 107526 |
Gene Summary | This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (5) lacks an alternate segment that spans both the central and 3' coding regions, and which results in a frameshift, compared to variant 1. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227696 | Gimap4 (myc-DDK-tagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 5 |
USD 200.00 |
{0} Product Review(s)
Be the first one to submit a review