Hmga1 (NM_001025427) Mouse Untagged Clone
CAT#: MC225663
Hmga1 (untagged) - Mouse high mobility group AT-hook 1 (Hmga1), transcript variant 2
"NM_001025427" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hmga1 |
Synonyms | AL023995; Hmga1a; Hmga1b; Hmgi; Hmgiy; Hmgy |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225663 representing NM_001025427
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGAGTCGGGCTCAAAGTCCAGCCAGCCCCTGGCCTCCAAGCAGGAAAAGGATGGGACTGAGAAGC GAGGCCGGGGCAGGCCACGCAAGCAGCCTCCGGTGAGTCCTGGGACGGCGCTGGTCGGGAGTCAGAAAGA GCCCAGTGAAGTGCCAACTCCGAAGAGACCTCGGGGCCGACCAAAGGGAAGCAAGAATAAGGGCGCCGCC AAGACCCGGAAAGTCACCACAGCTCCAGGGAGGAAACCAAGGGGCAGACCCAAGAAACTGGAGAAGGAGG AAGAGGAGGGCATCTCCCAGGAGTCCTCTGAGGAGGAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025427 |
Insert Size | 324 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone expresses the complete ORF with c-terminal tags of Myc-DDK. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001025427.3, NP_001020598.1 |
RefSeq Size | 1679 bp |
RefSeq ORF | 324 bp |
Locus ID | 15361 |
Cytogenetics | 17 14.5 cM |
Gene Summary | This locus encodes a member of the nuclear, non-histone high mobility group protein family. This architectural transcription factor binds to A-T rich DNA sequences and participates in enhanceosome formation, chromatin remodeling and regulation of transcription. This protein functions in many cellular processes, including cell growth and differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 5 encode the same isoform (a), also known as isoform I. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227874 | Hmga1 (myc-DDK-tagged) - Mouse high mobility group AT-hook 1 (Hmga1), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review