Hmga1 (NM_001025427) Mouse Untagged Clone

CAT#: MC225663

Hmga1 (untagged) - Mouse high mobility group AT-hook 1 (Hmga1), transcript variant 2


  "NM_001025427" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hmga1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hmga1
Synonyms AL023995; Hmga1a; Hmga1b; Hmgi; Hmgiy; Hmgy
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225663 representing NM_001025427
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGAGTCGGGCTCAAAGTCCAGCCAGCCCCTGGCCTCCAAGCAGGAAAAGGATGGGACTGAGAAGC
GAGGCCGGGGCAGGCCACGCAAGCAGCCTCCGGTGAGTCCTGGGACGGCGCTGGTCGGGAGTCAGAAAGA
GCCCAGTGAAGTGCCAACTCCGAAGAGACCTCGGGGCCGACCAAAGGGAAGCAAGAATAAGGGCGCCGCC
AAGACCCGGAAAGTCACCACAGCTCCAGGGAGGAAACCAAGGGGCAGACCCAAGAAACTGGAGAAGGAGG
AAGAGGAGGGCATCTCCCAGGAGTCCTCTGAGGAGGAGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025427
Insert Size 324 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025427.3, NP_001020598.1
RefSeq Size 1679 bp
RefSeq ORF 324 bp
Locus ID 15361
Cytogenetics 17 14.5 cM
Gene Summary This locus encodes a member of the nuclear, non-histone high mobility group protein family. This architectural transcription factor binds to A-T rich DNA sequences and participates in enhanceosome formation, chromatin remodeling and regulation of transcription. This protein functions in many cellular processes, including cell growth and differentiation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 5 encode the same isoform (a), also known as isoform I.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.