Ghrl (NM_001286404) Mouse Untagged Clone

CAT#: MC225715

Ghrl (untagged) - Mouse ghrelin (Ghrl), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ghrl
• Synonyms: 2210006E23Rik; Ghr; m46; MTLRP; MTLRPAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225715 representing NM_001286404
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGTCTTCAGGCACCATCTGCAGTTTGCTGCTACTCAGCATGCTCTGGATGGACATGGCCATGGCAG
  GCTCCAGCTTCCTGAGCCCAGAGCACCAGAAAGCCCAGAGAAAGGAATCCAAGAAGCCACCAGCTAAACT
  GCAGCCACGAGCTCTGGAAGGCTGGCTCCACCCAGAGGACAGAGGACAAGCAGAAGAGACAGAGGAGGAG
  CTGGAGATCAGGTTCAATGCTCCCTTCGATGTTGGCATCAAGCTGTCAGGAGCTCAGTATCAGCAGCATG
  GCCGGGCCCTGGGGAAGTTTCTTCAGGATATCCTCTGGGAAGAGGTCAAAGAGGCGCCAGCTGACAAGTA
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286404
• ORF Size: 351 bp
• Insert Size: 351
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001286404.1, NP_001273333.1
• RefSeq Size: 507
• RefSeq ORF: 351
• Locus ID: 58991
• Gene Summary: This gene encodes a preproprotein that undergoes proteolytic processing to yield two bioactive peptides, ghrelin and obestatin. The hormone ghrelin plays a role in enhancing appetite and has numerous other biological functions that include stimulating the secretion of growth hormone (somatotropin) from the anterior pituitary gland. Obestatin is thought to be a hormone that functions in decreasing appetite. Mice lacking the encoded protein develop normally and exhibit no gross anatomical abnormalities. This gene encodes distinct isoforms, some or all of which may undergo similar proteolytic processing. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 2) compared to isoform 1.