Fgf5 (NM_001277268) Mouse Untagged Clone

CAT#: MC225747

Fgf5 (untagged) - Mouse fibroblast growth factor 5 (Fgf5), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fgf5
• Synonyms: angora; Fgf-5; go; HBGF-5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225747 representing NM_001277268
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGCCTGTCCTTGCTCTTCCTCATCTTCTGCAGCCACCTGATCCACAGCGCTTGGGCTCACGGGGAGA
  AGCGTCTCACTCCCGAAGGGCAACCCGCGCCTCCTAGGAACCCGGGAGACTCCAGCGGCAGCCGGGGCAG
  AAGTAGCGCGACGTTTTCTTCGTCTTCTGCCTCCTCACCAGTCGCAGCTTCTCCGGGCAGCCAAGGAAGC
  GGCTCGGAACATAGCAGTTTCCAGTGGAGCCCTTCGGGGCGCCGGACCGGCAGCCTGTACTGCAGAGTGG
  GCATCGGTTTCCATCTGCAGATCTACCCGGATGGCAAAGTCAATGGCTCCCACGAAGCCAGTGTGTTAAG
  CCAAATTTACGGATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277268
• ORF Size: 366 bp
• Insert Size: 366
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001277268.1, NP_001264197.1
• RefSeq Size: 2449
• RefSeq ORF: 366
• Locus ID: 14176
• Gene Summary: This gene encodes a secreted protein that is a member of a family of heparin-binding growth factors. The encoded protein regulates cell proliferation, particularly the growth of hair follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
  Transcript Variant: This variant (2, also known as FGF-5S) lacks an alternate exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.