Ly6a (NM_001271418) Mouse Untagged Clone

CAT#: MC225830

Ly6a (untagged) - Mouse lymphocyte antigen 6 complex, locus A (Ly6a), transcript variant 4


  "NM_001271418" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ly6a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ly6a
Synonyms Ly-6A.2; Ly-6A/E; Ly-6E.1; Sca-1; Sca1; TAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225830 representing NM_001271418
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACACTTCTCACACTACAAAGTCCTGTTTGCTGATTCTTCTTGTGGCCCTACTGTGTGCAGAAAGAG
CTCAGGGACTGGAGTGTTACCAGTGCTATGGAGTCCCATTTGAGACTTCTTGCCCATCAATTACCTGCCC
CTACCCTGATGGAGTCTGTGTTACTCAGGAGGCAGCAGTTATTGTGGATTCTCAAACAAGGAAAGTAAAG
AACAATCTTTGCTTACCCATCTGCCCTCCTAATATTGAAAGTATGGAGATCCTGGGTACTAAGGTCAACG
TGAAGACTTCCTGTTGCCAGGAAGACCTCTGCAATGTAGCAGTTCCCAATGGAGGCAGCACCTGGACCAT
GGCAGGGGTGCTTCTGTTCAGCCTGAGCTCAGTCCTCCTGCAGACCTTGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271418
ORF Size 405 bp
Insert Size 405
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271418.1, NP_001258347.1
RefSeq Size 966
RefSeq ORF 405
Locus ID 110454
Gene Summary T-cell activation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses two alternate splice sites in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, 5, and 6 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.