Cck (NM_001284508) Mouse Untagged Clone

CAT#: MC225834

Cck (untagged) - Mouse cholecystokinin (Cck), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cck
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225834 representing NM_001284508
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGAGCGGCGTATGTCTGTGCGTGGTGATGGCAGTCCTAGCTGCTGGCGCCCTGGCGCAGCCGGTAG
  TCCCTGCAGAAGCTACGGACCCCGTGGAGCAGCGGGCGCAAGAGGCGCCCCGAAGGCAGCTGCGGGCTGT
  GCTCCGGACGGACGGCGAGCCCCGAGCGCGCCTGGGCGCACTGCTAGCGCGATACATCCAGCAGGTCCGC
  AAAGTGGCATGGATGGTGACCTCTGGTTGGGTGTTAACCTGGACCAGTAGAGCTGGATTAAAACACAGGA
  GGTGGGCATCCTTTCTGTGGAGCTCACGAACCCAATTTTTCCTGCCCGCATTTGAACAGCCCATGGCTTG
  TCGACCTGTCTGCATTTGGCTTGACTGCTCCTTCTGGCCGCATGTCCGTTCTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001284508
• ORF Size: 405 bp
• Insert Size: 405
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001284508.2, NP_001271437.1
• RefSeq Size: 870
• RefSeq ORF: 405
• Locus ID: 12424
• Gene Summary: This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Homozygous knockout mice for this gene exhibit impaired insulin secretion, enhanced insulin sensitivity, and resistance to obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (2) contains an alternate exon in the coding region, which results in a frameshift, compared to variant 1. The encoded protein (isoform 2) is longer, has a distinct C-terminus, compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform 1.