Ap3s1 (NM_001303015) Mouse Untagged Clone

CAT#: MC226015

Ap3s1 (untagged) - Mouse adaptor-related protein complex 3, sigma 1 subunit (Ap3s1), transcript variant 2

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ap3s1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226015 representing NM_001303015
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCAAGGCCATCCTCATCTTCAACAACCACGGGAAGCCGCGGCTCTCCAAGTTCTACCAGCCCTATA
  GTGAAGACACGCAACAGCAAATCATCAGGGAGACTTTCCATTTGGTGTCTAAGCGCGATGAGAACGTTTG
  TAATTTCCTAGAAGGAGGATTATTAATTGGAGGCTCTGACAACAAGCTCATTTACAGACATTATGCAACA
  CTATATTTTGTCTTCTGTGTGGACTCCTCAGAAAGTGAACTTGGCATTTTAGATCTAATTCAAGTATTTG
  TGGAAACATTAGACAAATGTTTTGAAAATGTTTGTGAACTGGATTTAATATTCCATGTAGACAAGGTTCA
  TAATATTCTTGCAGAAATGGTGATGGGGGGAATGGTATTGGAGACCAACATGAATGAGATTGTCACACAA
  ATTGATGCACAAAATAAACTGGAGAAATCTGAGACCTTTATCTTTCAGTCTCCCAGACAGGACAGGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001303015
• ORF Size: 489 bp
• Insert Size: 489
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001303015.1, NP_001289944.1
• RefSeq Size: 1561
• RefSeq ORF: 489
• Locus ID: 11777
• Gene Summary: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) contains an additional exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.