Cd27 (NM_001286753) Mouse Untagged Clone

CAT#: MC226180

Cd27 (untagged) - Mouse CD27 antigen (Cd27), transcript variant 3


  "NM_001286753" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cd27"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cd27
Synonyms S152; Tnfrsf7; Tp55
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226180 representing NM_001286753
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATGGCCACCTCCCTACTGGCTCTGCATGCTGGGGACCTTGGTAGGACTCTCAGCTACCCTAGCCC
CAAACAGCTGTCCAGACAAACACTACTGGACTGGGGGAGGACTCTGCTGCCGGATGTGTGAGCCAGGTAC
ATTCTTTGTGAAGGACTGTGAACAAGACAGAACAGCTGCTCAGTGTGATCCCTGTATACCAGGCACCTCC
TTCTCTCCAGACTACCACACCCGGCCCCACTGCGAGAGCTGCAGGCATTGTAACTCTGAGAAGCCATCCT
GGCCCCTACACAGGCAGCTTCCCAACTCGACTGTCTATAGCCAGCGGTCATCCCATAGACCCCTGTGCAG
CTCGGACTGCATCCGGATCTTTGTGACCTTCTCCAGCATGTTTCTTATCTTCGTCCTGGGTGCAATCTTG
TTCTTCCATCAAAGAAGAAACCACGGGCCAAATGAAGACCGGCAGGCAGTGCCTGAAGAGCCTTGTCCTT
ACAGCTGCCCCAGGGAAGAGGAGGGCAGTGCTATCCCTATCCAGGAGGACTACCGGAAACCCGAGCCTGC
TTTCTACCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286753
ORF Size 573 bp
Insert Size 573
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001286753.1, NP_001273682.1
RefSeq Size 1396
RefSeq ORF 573
Locus ID 21940
Gene Summary Receptor for CD70/CD27L. May play a role in survival of activated T-cells. May play a role in apoptosis through association with SIVA1. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform c, which is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.