Gimap4 (NM_001243200) Mouse Untagged Clone

CAT#: MC226259

Gimap4 (untagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 4

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gimap4
• Synonyms: AU019574; E430007K16Rik; Ian-1; Ian1; Imap4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226259 representing NM_001243200
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGTCCAGTGCGGTGGTGCGGGGTTCATCCCAGAAAGTTCAAGGAGCAGCCATGAGCTTGGAAACC
  AAGATCAAGGAATTCCCCAACTGAGAATTGTCTTACTTGGAAAAACTGGAGCAGGAAAGAGTTCAACAGG
  GAACAAGGTGATGCATGAGTTCCAGAATCGCTACTGTTTGTTCAACAACAGAGCCTCAGGCGCTGAAAAG
  GAAGAGCAGAAGATGCAATTGTTGACCTTGGTCCAGAGCATGGTGAGGGAAAATGGTGGAAGATGCTTTA
  CTAATAAGATGTATGAAAGTGCCGAGTGTGTGATCCAGAAAGAGACCTTGAGGATGCAAGAATTATACAG
  AGAGGAGCTAGAGAGGGAGAAAGCACGGATAAGACGGGAGTATGAAGAACAGATTAAAGATCTGAGAGAT
  GAACTGGAGAGGGAAATAAGAAGGGCACGTATGGAGAGGGAATTCAAGGAGAGGGAGGCTATCTTTACAA
  AGAATCAACAAAATGCTAGGAAGGAAGTTGAGAACACAAGTATGATACTTGAATTAATTATAAAAGCATG
  GGAGATTGCTTCCTTTATCTTCAACCAGTTTATGAAAGACTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243200
• ORF Size: 603 bp
• Insert Size: 603
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001243200.1, NP_001230129.1
• RefSeq Size: 1430
• RefSeq ORF: 603
• Locus ID: 107526
• Gene Summary: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (4) lacks an alternate in-frame segment in the central coding region, compared to variant 1, resulting in an isoform (d) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.