Taz (NM_001242615) Mouse Untagged Clone

CAT#: MC226273

Taz (untagged) - Mouse tafazzin (Taz), transcript variant 3


  "NM_001242615" in other vectors (1)

Reconstitution Protocol

USD 210.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Taz
Synonyms 5031411C02Rik; 9130012G04Rik; AW107266; AW552613; G4.5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226273 representing NM_001242615
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCTCCATGTGAAGTGGCCATTCCCCGCGGTGCCCCGGCTCACCTGGACTCTAGCCAGCAGCGTCG
TCATGGGCCTAGTTGGCACCTACAGCTGCTTCTGGACCAAGTACATGAACCACCTCACCGTGCACAACAA
GGAAGTGCTGTATGAGCTCATTGAGAACCGAGGCCCTGCCACCCCCCTTATCACCGTCTCCAACCACCAG
TCTTGCATGGATGACCCTCATCTCTGGGGGATCCTAAAACTCCGCCACATCTGGAACCTGAAGTTGATGC
GTTGGACCCCAGCAGCTGCAGACATCTGCTTCACCAAGGAGCTGCACTCCCATTTCTTCAGCTTGGGCAA
ATGTGTGCCTGTGTGTCGAGGAGATGGTGTCTACCAGAAAGGGATGGACTTCATTTTGGAGAAGCTTAAC
CATGGGGACTGGGTGCACATCTTCCCAGAAGGGAAAGTAAACATGAGTTCTGAGTTCCTGCGCTTCAAAT
GGGTAGGAATTGGACGGCTGATTGCTGAGTGTCATCTGAATCCCATCATCCTGCCACTGTGGCATGTTGA
AAATCACCGTGCTGATTGGGAAGCCCTTCAGTACACTCCCTGTGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001242615
ORF Size 609 bp
Insert Size 609
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001242615.2, NP_001229544.1
RefSeq Size 1780
RefSeq ORF 609
Locus ID 66826
Gene Summary This gene encodes a mitochondrial phospholipid-lysophospholipid transacylase necessary for normal composition and content of cardiolipin. In humans, mutations of this gene result in Barth syndrome, most often characterized by cardioskeletal myopathy, neutropenia and abnormal mitochondria. This gene is distinct from the gene encoding transcriptional coactivator with PDZ binding motif. Both genes share the gene symbol Taz. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (3) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.