Taz (NM_001242615) Mouse Untagged Clone

CAT#: MC226273

Taz (untagged) - Mouse tafazzin (Taz), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Taz
• Synonyms: 5031411C02Rik; 9130012G04Rik; AW107266; AW552613; G4.5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226273 representing NM_001242615
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCCCTCCATGTGAAGTGGCCATTCCCCGCGGTGCCCCGGCTCACCTGGACTCTAGCCAGCAGCGTCG
  TCATGGGCCTAGTTGGCACCTACAGCTGCTTCTGGACCAAGTACATGAACCACCTCACCGTGCACAACAA
  GGAAGTGCTGTATGAGCTCATTGAGAACCGAGGCCCTGCCACCCCCCTTATCACCGTCTCCAACCACCAG
  TCTTGCATGGATGACCCTCATCTCTGGGGGATCCTAAAACTCCGCCACATCTGGAACCTGAAGTTGATGC
  GTTGGACCCCAGCAGCTGCAGACATCTGCTTCACCAAGGAGCTGCACTCCCATTTCTTCAGCTTGGGCAA
  ATGTGTGCCTGTGTGTCGAGGAGATGGTGTCTACCAGAAAGGGATGGACTTCATTTTGGAGAAGCTTAAC
  CATGGGGACTGGGTGCACATCTTCCCAGAAGGGAAAGTAAACATGAGTTCTGAGTTCCTGCGCTTCAAAT
  GGGTAGGAATTGGACGGCTGATTGCTGAGTGTCATCTGAATCCCATCATCCTGCCACTGTGGCATGTTGA
  AAATCACCGTGCTGATTGGGAAGCCCTTCAGTACACTCCCTGTGCTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242615
• ORF Size: 609 bp
• Insert Size: 609
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001242615.2, NP_001229544.1
• RefSeq Size: 1780
• RefSeq ORF: 609
• Locus ID: 66826
• Gene Summary: This gene encodes a mitochondrial phospholipid-lysophospholipid transacylase necessary for normal composition and content of cardiolipin. In humans, mutations of this gene result in Barth syndrome, most often characterized by cardioskeletal myopathy, neutropenia and abnormal mitochondria. This gene is distinct from the gene encoding transcriptional coactivator with PDZ binding motif. Both genes share the gene symbol Taz. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (3) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.