Ywhaz (NM_001253807) Mouse Untagged Clone

CAT#: MC226391

Ywhaz (untagged) - Mouse tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz), transcript variant 4


  "NM_001253807" in other vectors (1)

Reconstitution Protocol

USD 230.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ywhaz"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ywhaz
Synonyms 14-3-3zeta; 1110013I11Rik; AI596267; AL022924; AU020854
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226391 representing NM_001253807
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCCTGCATGAAGTCTGTCACTGAGCAGGGAGCTGAGCTGTCGAATGAGGAGAGAAACCTTCTCT
CTGTTGCTTATAAAAACGTTGTAGGAGCCCGTAGGTCATCGTGGAGGGTCGTCTCAAGTATTGAGCAGAA
GACGGAAGGTGCTGAGAAAAAGCAGCAGATGGCTCGAGAATACAGAGAGAAGATCGAGACGGAGCTGCGT
GACATCTGCAACGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCGCAACCAGAAAGCA
AAGTCTTCTATTTGAAAATGAAGGGTGACTACTACCGTTACTTGGCCGAGGTTGCTGCTGGTGATGACAA
GAAAGGAATTGTGGACCAGTCACAGCAAGCATACCAAGAAGCATTTGAAATCAGCAAAAAGGAGATGCAG
CCGACACACCCCATCAGACTGGGTCTGGCCCTCAACTTCTCTGTGTTCTATTACGAGATCCTGAACTCCC
CAGAGAAAGCCTGCTCTCTTGCAAAAACAGCTTTCGATGAAGCCATTGCTGAACTTGATACATTAAGTGA
AGAGTCGTACAAAGACAGCACGCTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCGGAT
ACCCAAGGAGATGAAGCAGAAGCAGGAGAAGGAGGGGAAAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253807
ORF Size 675 bp
Insert Size 675
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001253807.1, NP_001240736.1
RefSeq Size 3160
RefSeq ORF 675
Locus ID 22631
Gene Summary Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, which results in a downstream AUG start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.