Ifng (NM_008337) Mouse Tagged ORF Clone

CAT#: MR227155

  • TrueORF®

Ifng (Myc-DDK-tagged) - Mouse interferon gamma (Ifng)


  "NM_008337" in other vectors (4)


Interest in protein/lysate? Submit request here!

Reconstitution Protocol

USD 68.00

USD 390.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ifng"

Specifications

Product Data
Type Mouse Tagged ORF Clone
Tag Myc-DDK
Symbol Ifng
Synonyms Ifg; IFN-g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MR227155 representing NM_008337
Red=Cloning site Blue=ORF Green=Tags(s)

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGCTACACACTGCATCTTGGCTTTGCAGCTCTTCCTCATGGCTGTTTCTGGCTGTTACTGCCACG
GCACAGTCATTGAAAGCCTAGAAAGTCTGAATAACTATTTTAACTCAAGTGGCATAGATGTGGAAGAAAA
GAGTCTCTTCTTGGATATCTGGAGGAACTGGCAAAAGGATGGTGACATGAAAATCCTGCAGAGCCAGATT
ATCTCTTTCTACCTCAGACTCTTTGAAGTCTTGAAAGACAATCAGGCCATCAGCAACAACATAAGCGTCA
TTGAATCACACCTGATTACTACCTTCTTCAGCAACAGCAAGGCGAAAAAGGATGCATTCATGAGTATTGC
CAAGTTTGAGGTCAACAACCCACAGGTCCAGCGCCAAGCATTCAATGAGCTCATCCGAGTGGTCCACCAG
CTGTTGCCGGAATCCAGCCTCAGGAAGCGGAAAAGGAGTCGCTGC


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
ACCN NM_008337
ORF Size 465 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Reference Data
RefSeq NM_008337.1, NM_008337.2, NM_008337.3, NM_008337.4, NP_032363.1
RefSeq Size 1207
RefSeq ORF 468
Locus ID 15978
MW 18.4 kDa
Gene Summary This gene encodes a soluble cytokine that is a member of the type II interferon class. The encoded protein is secreted by cells of both the innate and adaptive immune systems. The active protein is a homodimer that binds to the interferon gamma receptor which triggers a cellular response to viral and microbial infections. Mice deficient in this gene have increased susceptibility to viral, bacterial and parasitic infections and to several autoimmune diseases. [provided by RefSeq, Dec 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Order online and get additional $20 off!

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.