Pard6a (NM_001003654) Rat Untagged Clone

CAT#: RN200099

Pard6a (untagged ORF) - Rat par-6 (partitioning defective 6,) homolog alpha (C. elegans) (Pard6a), transcript variant 2, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Pard6a
• Synonyms: Par-6a; Par6a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200099 representing NM_001003654
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGTGTTCGTGTGGCTCCTCAGGGTCTGGAGCGGGTACCTGGGATCTTCATCTCCCGCCTGGTCCGTG
  GGGGCCTGGCTGAGAGCACAGGGCTGCTGGCGGTCAGTGATGAGATCCTCGAGGTCAACGGCATTGAGGT
  GGCCGGGAAGACCTTGGACCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTC
  AAGCCTGCCAACCAGCGTAATAATGTGGTACGAGGGGCATCTGGGCGTCTGACAGGGCCTTCTTCTGTAG
  GGCCTGGGCCTACTGATCCTGACAGTGACGATGACAACAGTGACCCGGTCATTGAAAATCGCCACCCTCC
  CTGTTCTAATGGGCTGTCTCAGGGACCCCTGTGCTGGGACCTGCAACCTGGCTGCCTACTTCCTAGTGCT
  GGCAGCTCTCTGCCCTCCTTGGATAGCAGAGAGCAAGCCAATTCTGGCTGGGGGAATGGCATGCGAGGTG
  ATGTTAGTGGATTCAGCCTTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001003654
• Insert Size: 513 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001003654.2, NP_001003654.2
• RefSeq Size: 1221 bp
• RefSeq ORF: 513 bp
• Locus ID: 307799
• Cytogenetics: 19q12
• Gene Summary: The protein encoded by this gene is a component of the partitioning defective complex, a protein complex involved in controlling epithelial cell polarity as well as other cell processes. In rat testis cells, the protein localizes to the apical ectoplasmic specialization at the Sertoli-elongating spermatid interface and at the blood-testis barrier. Accordingly, knockdown of this gene in Sertoli cell epithelia results in compromised blood-testis barrier integrity. Knockdown of this gene in various neuronal cell types results in a variety of phenotypes including abnormal dendritic spine morphogenesis and defective axon outgrowth to the spinal midline. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
  Transcript Variant: This variant (2) differs in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.