Pkib (NM_012627) Rat Untagged Clone

CAT#: RN200492

Pkib (untagged ORF) - Rat protein kinase inhibitor beta, (cAMP-dependent, catalytic) inhibitor beta (Pkib), transcript variant 2, (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Pkib
• Synonyms: PKINH; Prkacn2; RATPKINH
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN200492 representing NM_012627
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGGACAGATTCATCGGAGATGACTGATGTGGAATCTGTAATCAGCAGCTTCGCGTCTTCAGCAAGGG
  CGGGCCGCCGCAATGCCTTACCCGACATCCAGAGTTCACTGGCTACAGGTGGATCCCCTGATCTTGCACT
  GAAGCTGGAGGCATTGGCTGTGAAGGAAGATGCAAAAATGAAGAATGAAGAGAAAGACCAAGGCCAACCG
  AAAAAGCCCCTAGACGAAGACAAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012627
• ORF Size: 237 bp
• Insert Size: 237
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_012627.3, NP_036759.2
• RefSeq Size: 1415
• RefSeq ORF: 237
• Locus ID: 24678
• Gene Summary: displays strong inhibition of the activity of cAMP-dependent protein kinase [RGD, Feb 2006]
  Transcript Variant: This variant (2) lacks an internal exon compared to variant 1, which results in translation initiation from an in-frame downstream AUG and an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.