Cops9 (NM_001109044) Rat Untagged Clone

CAT#: RN200769

Myeov2 (untagged ORF) - Rat myeloma overexpressed 2 (Myeov2), (10 ug)


  "NM_001109044" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cops9"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cops9
Synonyms Myeov2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200769 representing NM_001109044
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAACCAGCTGTGGATGAGATGTTTCCCGAGGGCGCGGGGCCCTATGTAGACTTGGATGAGGCTGGAG
GTAGCACCGGGCTCCTGATGGACTTGGCAGCCAATGAAAAGGCAGTTCATGCGGACTTTTTTAACGATTT
TGAAGATCTCTTTGATGATGATGATGTCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001109044
ORF Size 174 bp
Insert Size 174
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001109044.1, NP_001102514.1
RefSeq Size 486
RefSeq ORF 174
Locus ID 681389

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.