Pkia (NM_053772) Rat Untagged Clone

CAT#: RN200945

Pkia (untagged ORF) - Rat protein kinase (cAMP-dependent, catalytic) inhibitor alpha (Pkia), (10 ug)


  "NM_053772" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pkia"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pkia
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN200945 representing NM_053772
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGATGTGGAAACTACGTATGCAGATTTTATTGCCTCAGGAAGAACAGGTAGAAGAAATGCAATAC
ATGATATCTTGGTTTCCTCTGCAAGTGGCAACAGCAATGAATTAGCCTTGAAATTAGCAGGTCTTGATAT
TAACAAGACAGAAGGTGAAGATGATGGACAGAGAAGCTCCACAGAACAAAGTGGCGAAGCCCAGGGAGAA
GCAGCCAAGTCTGAAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053772
ORF Size 231 bp
Insert Size 231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053772.2, NP_446224.1
RefSeq Size 1971
RefSeq ORF 231
Locus ID 114906
Gene Summary inhibits cAMP-dependent protein kinase; may bind to the protein kinase catalytic site [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.