Rasl10a (NM_001108862) Rat Untagged Clone

CAT#: RN215478

Rasl10a (untagged ORF) - Rat RAS-like, family 10, member A (Rasl10a), (10 ug)


  "NM_001108862" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rasl10a"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rasl10a
Synonyms RGD1306100
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215478 representing NM_001108862
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATGGGGGAAAGAGCAGCAGGCGTTTAGGCCAGAGGGCTTTACCCGTACAGCTGCACTGGGAATTAG
AGGCAGTAGGAGCATACGTTGGGAGTGGCCGGACCCTAAAGACTGGAGCTTGCAGGACACGGATGCCTTT
GTGCTGGTCTACGACATCTGCAGCCCGGACAGTTTCGATTATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001108862
ORF Size 186 bp
Insert Size 186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001108862.1, NP_001102332.1
RefSeq Size 974
RefSeq ORF 186
Locus ID 364190

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.