Dclk1 (NM_021584) Rat Untagged Clone

CAT#: RN215709

Dclk1 (untagged) - Rat doublecortin-like kinase 1 (Dclk1), transcript variant 2

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Dclk1
• Synonyms: Ania4; Cpg16; Dcamkl1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215709 representing NM_021584
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTAGAACTCATAGAAGTTAATGGAACCCCTGGCAGTCAGCTCTCCACTCCGCGCTCCGGCAAGTCAC
  CAAGTCCATCGCCCACCAGCCCAGGAAGCCTGCGGAAGCAGAGGGACCTGTACCGCCCTCTCTCGTCGGA
  TGATTTGGACTCAGTAGGAGACTCAGTGTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021584
• ORF Size: 171 bp
• Insert Size: 171
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_021584.2, NP_067595.1
• RefSeq Size: 4819
• RefSeq ORF: 171
• Locus ID: 83825
• Gene Summary: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The typical protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the protein is independent of its protein kinase activity. This gene is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the full-length nature of the variant produced from the 5' promoter has not been determined. Current reference sequence data represents two alternatively spliced transcript variants produced from the 3' promoter and their protein products lack the doublecortin domain. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (2) is produced from the 3' promoter. It lacks multiple 3' exons but has an alternate 3' exon, as compared to variant 1. The resulting isoform [2, also known as ania-4, or CARP (CaMK-related peptide)] is only 56 aa long and mainly consists of the serine/proline-rich domain. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.