Coa5 (NM_001195488) Rat Untagged Clone

CAT#: RN215730

Coa5 (untagged) - Rat cytochrome C oxidase assembly factor 5 (Coa5)


  "NM_001195488" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Coa5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Coa5
Synonyms RGD1565095
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215730 representing NM_001195488
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCGGTATTATGAGGACAAGCCGGAGGGCGGCGCGTGTGCGGGCGTGAAGGAGGATCTGGGTGCAT
GTCTGCTGCAGTCGGCCTGTGTGCTCCAGGAAGGAAAGTCCCCACGGCAGTGCTTGAAGGAAGGCAACTG
TAGAGCTTTGCAGTACTCGTTTTTTGAGTGTAAGAGATCAATGTTGGATGCCAGATCAAGATTCAGAGGA
AGAAAAGGATATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001195488
ORF Size 225 bp
Insert Size 225
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001195488.1, NP_001182417.1
RefSeq Size 3869
RefSeq ORF 225
Locus ID 503252

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.