Hfe (NM_001173435) Rat Untagged Clone

CAT#: RN215952

Hfe (untagged) - Rat hemochromatosis (Hfe), transcript variant 3


  "NM_001173435" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Hfe
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215952 representing NM_001173435
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCGATCAGCTGGGCTCCCTGTGCGGCTGCTATTGCTGCTGCTGTTGTTGCTGCTGTGGTCCGTGG
CCCCGCAGGCGCTGCGGCCCGTGCCTACTTTGGTGAAAGTGACTCGCCACTGGGCCTCTACAGGGACCTC
TCTAAGGTGTCAGGCTCTGAATTTCTTCCCCCAGAACATCACTATGAGGTGGTTGAAGGACAGCCAGCCC
CTAGATGCCAAGGATGTCAACCCTGAGAACGTGCTGCCAAATGGGGATGGGACCTATCAGGGCTGGCTGA
CCTTGGCTGTGGCCCCTGGAGAAGAGACAAGGTTCAGCTGTCAAGTGGAGCACCCAGGCCTGGATCAGCC
TCTCACTGCCACTTGGGAGCCCTCACGGTCTCAGGACATGATTATTGGAATCATAAGTGGGATCACCATT
TGTGCCATCTTCTTTGTTGGAATTCTGATCCTAGTCTTAAGGAAAAGGAAGGTTTCAGGAGGAACCATGG
GTGACTATGTCTTAACAGAGTGTGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001173435
ORF Size 519 bp
Insert Size 519
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001173435.1, NP_001166906.1
RefSeq Size 1106
RefSeq ORF 519
Locus ID 29199
Gene Summary membrane protein; may be involved with iron metabolism; defects in human homolog lead to hereditary hemochromotosis, an iron storage disorder [RGD, Feb 2006]
Transcript Variant: This variant (3) lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform 3) is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.