Gnas (NM_001159653) Rat Untagged Clone

CAT#: RN216170

Gnas (untagged) - Rat GNAS complex locus (Gnas), transcript variant 4

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Gnas
• Synonyms: ALEX; G-alpha-8; Gnas1; Gnpas; Nesp55; SCG6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216170 representing NM_001159653
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATCGCAGGTCCCGGGCTCATCAGTGGCGCCGAGCTCGCCATAATTACAACGACCTGTGCCCGCCCA
  TAGGCCGCCGGGCTGCTACCGCTCTCCTCTGGCTCTCCTGCTCCATCGCTCTCCTCCGCGCCCTAGCCTC
  TTCCAACGCCCGCGCCCAGCAGCGGGCTGCCCAGCGCCGGAGCTTCCTTAACGCCCACCACCGCTCCGCT
  GCCGCTGCAGCTGCCGCACAGGTACTCCCCGAGTCCTCTGAATCCGAATCTGATCACGAGCACGAGGAGG
  CTGAGCCTGAGCTGGCCCGCCCCGAGTGCCTAGAGTACGATCAGGACGACTACGAGACCGAGACCGATTC
  TGAGACCGAGCCTGAGTCCGATATCCAGTCCGAGACCGAATTCGAGACCGAGCCTGAGACCGAGCCTGAG
  ACCGCCCCTACAACTGAGCCTGAGACCGAACCAGAGGACGAGCGCGGCCCCCGGGGCGCCACCTTCAACC
  AGTCACTCACTCAGCGTCTGCACGCTCTGAAGTTGCAGAGCGCCGACGCCTCCCCGAGACGTGCGCAGCC
  CACCACTCAGGAGCCTGAGAGCGCAAGCGAGGGGGAGGAGCCCCAGCGCGAGCCCTTAGACGAGGATCCT
  CGGGACCCCGAGGAGTCAGAGGAGCTCAGGGAGGCGAACAGGCAGCCCCGCCGCTGCAAGACCAGGAGGC
  CAGCCCGCCGTCGCGACCAGTCCCCGGAGTCCCCTCCCAGAAAGGGGCCCATCCCCATCCGGCGTCACTA
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001159653
• ORF Size: 771 bp
• Insert Size: 771
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001159653.1, NP_001153125.1
• RefSeq Size: 2543
• RefSeq ORF: 771
• Locus ID: 24896
• Gene Summary: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants have been found for this gene. [provided by RefSeq, Apr 2009]
  Transcript Variant: This variant (4) is maternally expressed. It has alternate 5' exons, as compared to variant 3. Variants 4 and 5 both encode neuroendocrine secretory protein 55 (NESP55), which localizes to large secretory vesicles of endocrine cells and neurons. The coding regions of variants 4 and 5 do not overlap the coding regions used by other transcripts; thus NESP55 has no similarity to isoforms of the G-protein alpha subunit.