Cholecystokinin (CCK) (NM_000729) Human Untagged Clone

CAT#: SC119730

CCK (untagged)-Human cholecystokinin (CCK), transcript variant 1


  "NM_000729" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000729 edited
ATGAACAGCGGCGTGTGCCTGTGCGTGCTGATGGCGGTACTGGCGGCTGGCGCCCTGACG
CAGCCGGTGCCTCCCGCAGATCCCGCGGGCTCCGGGCTGCAGCGGGCAGAGGAGGCGCCC
CGTAGGCAGCTGAGGGTATCGCAGAGAACGGATGGCGAGTCCCGAGCGCACCTGGGCGCC
CTGCTGGCAAGATACATCCAGCAGGCCCGGAAAGCTCCTTCTGGACGAATGTCCATCGTT
AAGAACCTGCAGAACCTGGACCCCAGCCACAGGATAAGTGACCGGGACTACATGGGCTGG
ATGGATTTTGGCCGTCGCAGTGCCGAGGAGTATGAGTACCCCTCCTAG
>OriGene 5' read for NM_000729 unedited
CACGAGGCCGGGCTGCTCCGGTTGGAAACGCCAAGCCAGCTGCGTCCTAATCCAAAAGCC
ATGAACAGCGGCGTGTGCCTGTGCGTGCTGATGGCGGTACTGGCGGCTGGCGCCCTGACG
CANCCGGTGCCTCCCGCAGATCCCGCGGGCTCCGGGCTGCAGCGGGCAGAGGAGGCGCCC
CGTAGGCAGCTGAGGGTATCGCAGAGAACGGATGGCGAGTCCCGAGCGCACCTGGGCGCC
CTGCTGGCAAGATACATCCAGCAGGCCCGGAAAGCTCCTTCTGGACGAATGTCCATCGTT
AAGAACCTGCAGAACCTGGACCCCAGCCACAGGATAAGTGACCGGGACTACATGGGCTGG
ATGGATTTTGGCCGTCGCAGTGCCGAGGAGTATGAGTACCCCTCCTAGAGGACCCAGCCG
CCATCAGCCCAACGGGAAGCAACCTCCCAACCCAGAGGAGGCAGAATAAGAAAACAATCA
CACTCATAACTCATTGTCTGGTGGGAGTTTGACATTGTATGTATCTATTNAATTAAGTTC
TCAATGTGAAAN
Restriction Sites NotI-NotI     
ACCN NM_000729
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000729.3, NP_000720.1
RefSeq Size 851 bp
RefSeq ORF 348 bp
Locus ID 885
Cytogenetics 3p22.1
Domains Gastrin
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.