CCL3L3 (NM_001001437) Human Untagged Clone

CAT#: SC300192

CCL3L3 (untagged)-Human chemokine (C-C motif) ligand 3-like 3 (CCL3L3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCL3L3
• Synonyms: 464.2; D17S1718; G0S19-2; LD78; LD78BETA; SCYA3L; SCYA3L1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001001437, the custom clone sequence may differ by one or more nucleotides
  ATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGCAACCAG
  GTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCC
  CGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAG
  CCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAG
  TGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001001437
• ORF Size: 282 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001001437.2, NP_001001437.1
• RefSeq Size: 775
• RefSeq ORF: 282
• Locus ID: 414062
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• Gene Summary: This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility. [provided by RefSeq, Apr 2014]