PARVB (NM_001003828) Human Untagged Clone
CAT#: SC300567
PARVB (untagged)-Human parvin, beta (PARVB), transcript variant 1
"NM_001003828" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PARVB |
Synonyms | CGI-56 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001003828, the custom clone sequence may differ by one or more nucleotides
ATGCACCATGTGTTTAAAGATCACCAAAGAGGAGAGAAAAGGGGATTCCTTAGTCCAGAGAACAAAAACT GCAGGAGGCTGGAGCTGAGACGTGGGTGTTCCTGCAGCTGGGGCCTGTGCTCCCAGGCACTCATGGCTTC TCTGGCTGGTTCACTTCTCCCTGGCTCAGACAGATCAGGAGTGGAAACATCTGAATATGCTCAAGGAGGA GTGAGTGACCTGCAGGAAGAAGGCAAGAATGCCATCAACTCACCGATGTCCCCCGCCCTGGTGGATGTTC ACCCTGAAGACACCCAGCTTGAGGAGAACGAGGAGCGCACGATGATTGACCCCACTTCCAAGGAAGACCC CAAGTTCAAGGAACTGGTCAAGGTCCTCCTCGACTGGATTAATGACGTGCTGGTGGAGGAGAGGATCATT GTGAAGCAGCTGGAGGAAGACCTGTATGACGGCCAGGTGCTGCAGAAGCTCTTGGAAAAACTGGCAGGGT GCAAGCTGAATGTGGCTGAGGTGACACAGTCCGAAATAGGGCAGAAACAGAAGCTGCAGACGGTGCTGGA AGCAGTACATGACCTGCTGCGGCCCCGAGGCTGGGCGCTCCGGTGGAGCGTGGACTCAATTCACGGGAAG AACCTGGTGGCCATCCTCCACCTGCTGGTCTCTCTGGCCATGCACTTCAGGGCCCCCATCCGCCTTCCTG AGCATGTAACGGTGCAGGTGGTGGTCGTGCGGAAACGGGAAGGCCTGCTGCATTCCAGCCACATCTCGGA GGAGCTGACCACAACTACAGAGATGATGATGGGCCGGTTCGAGCGGGATGCCTTCGACACGCTGTTCGAC CACGCCCCGGATAAGCTCAGCGTGGTGAAGAAGTCTCTCATCACTTTTGTGAACAAGCACCTGAACAAGC TGAATTTGGAGGTGACGGAACTGGAGACCCAGTTTGCAGATGGCGTGTACCTGGTTCTGCTCATGGGCCT TCTGGAAGACTACTTTGTTCCTCTCCACCACTTCTACCTGACTCCGGAAAGCTTCGATCAGAAGGTCCAC AATGTGTCCTTCGCCTTTGAGCTGATGCTGGACGGAGGCCTCAAGAAACCCAAGGCTCGTCCTGAAGACG TGGTTAACTTGGACCTCAAATCCACCCTGAGGGTTCTTTACAACCTGTTCACCAAGTACAAGAACGTGGA GTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001003828 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003828.2, NP_001003828.1 |
RefSeq Size | 1891 bp |
RefSeq ORF | 1194 bp |
Locus ID | 29780 |
Cytogenetics | 22q13.31 |
Protein Pathways | Focal adhesion |
Gene Summary | This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1, also known as CLINT or ParvB3) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218650 | PARVB (Myc-DDK-tagged)-Human parvin, beta (PARVB), transcript variant 1 |
USD 420.00 |
|
RG218650 | PARVB (GFP-tagged) - Human parvin, beta (PARVB), transcript variant 1 |
USD 460.00 |
|
RC218650L3 | Lenti-ORF clone of PARVB (Myc-DDK-tagged)-Human parvin, beta (PARVB), transcript variant 1 |
USD 620.00 |
|
RC218650L4 | Lenti-ORF clone of PARVB (mGFP-tagged)-Human parvin, beta (PARVB), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review