PARVB (NM_001003828) Human Untagged Clone

CAT#: SC300567

PARVB (untagged)-Human parvin, beta (PARVB), transcript variant 1


  "NM_001003828" in other vectors (4)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PARVB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PARVB
Synonyms CGI-56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001003828, the custom clone sequence may differ by one or more nucleotides


ATGCACCATGTGTTTAAAGATCACCAAAGAGGAGAGAAAAGGGGATTCCTTAGTCCAGAGAACAAAAACT
GCAGGAGGCTGGAGCTGAGACGTGGGTGTTCCTGCAGCTGGGGCCTGTGCTCCCAGGCACTCATGGCTTC
TCTGGCTGGTTCACTTCTCCCTGGCTCAGACAGATCAGGAGTGGAAACATCTGAATATGCTCAAGGAGGA
GTGAGTGACCTGCAGGAAGAAGGCAAGAATGCCATCAACTCACCGATGTCCCCCGCCCTGGTGGATGTTC
ACCCTGAAGACACCCAGCTTGAGGAGAACGAGGAGCGCACGATGATTGACCCCACTTCCAAGGAAGACCC
CAAGTTCAAGGAACTGGTCAAGGTCCTCCTCGACTGGATTAATGACGTGCTGGTGGAGGAGAGGATCATT
GTGAAGCAGCTGGAGGAAGACCTGTATGACGGCCAGGTGCTGCAGAAGCTCTTGGAAAAACTGGCAGGGT
GCAAGCTGAATGTGGCTGAGGTGACACAGTCCGAAATAGGGCAGAAACAGAAGCTGCAGACGGTGCTGGA
AGCAGTACATGACCTGCTGCGGCCCCGAGGCTGGGCGCTCCGGTGGAGCGTGGACTCAATTCACGGGAAG
AACCTGGTGGCCATCCTCCACCTGCTGGTCTCTCTGGCCATGCACTTCAGGGCCCCCATCCGCCTTCCTG
AGCATGTAACGGTGCAGGTGGTGGTCGTGCGGAAACGGGAAGGCCTGCTGCATTCCAGCCACATCTCGGA
GGAGCTGACCACAACTACAGAGATGATGATGGGCCGGTTCGAGCGGGATGCCTTCGACACGCTGTTCGAC
CACGCCCCGGATAAGCTCAGCGTGGTGAAGAAGTCTCTCATCACTTTTGTGAACAAGCACCTGAACAAGC
TGAATTTGGAGGTGACGGAACTGGAGACCCAGTTTGCAGATGGCGTGTACCTGGTTCTGCTCATGGGCCT
TCTGGAAGACTACTTTGTTCCTCTCCACCACTTCTACCTGACTCCGGAAAGCTTCGATCAGAAGGTCCAC
AATGTGTCCTTCGCCTTTGAGCTGATGCTGGACGGAGGCCTCAAGAAACCCAAGGCTCGTCCTGAAGACG
TGGTTAACTTGGACCTCAAATCCACCCTGAGGGTTCTTTACAACCTGTTCACCAAGTACAAGAACGTGGA
GTGA


Restriction Sites SgfI-MluI     
ACCN NM_001003828
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001003828.2, NP_001003828.1
RefSeq Size 1891 bp
RefSeq ORF 1194 bp
Locus ID 29780
Cytogenetics 22q13.31
Protein Pathways Focal adhesion
Gene Summary This gene encodes a member of the parvin family of actin-binding proteins, which play a role in cytoskeleton organization and cell adhesion. These proteins are associated with focal contacts and contain calponin homology domains that bind to actin filaments. This family member binds to alphaPIX and alpha-actinin, and it can inhibit the activity of integrin-linked kinase. This protein also functions in tumor suppression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1, also known as CLINT or ParvB3) represents the longest transcript and encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.