MARCHF2 (NM_001005416) Human Untagged Clone
CAT#: SC300950
41335 (untagged)-Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3
"NM_001005416" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MARCHF2 |
Synonyms | HSPC240; MARCH-II; MARCH2; RNF172 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001005416 edited
ATGACGACGGGTGACTGCTGCCACCTCCCCGGCTCCCTGTGTGACTGCTCCGGCAGCCCT GCCTTCTCCAAGGTCGTGGAGGCTACGGGCCTCGGACCGCCCCAGTATGTGGCACAGGTG ACTTCAAGGGATGGCCGGCTCCTCTCCACCGTCATCCGTGCCTTGGACACACCGAGTGAT GGTCCTTTCTGCCGGATCTGCCATGAGGGAGCGAACGGGGAGTGCTTGCTGTCCCCGTGT GGCTGCACCGGCACGCTGGGTGCCGTGCATAAGAGCTGTCTGGAGAAGTGGCTTTCCTCA TCTAACACCAGCTACTGCGAGCTGTGCCACACGGAGTTTGCAGTGGAGAAACGGCCTCGA CCCCTCACAGAGGTCTCCTTCCGCTACCACTGCCAGCTGTACTCCGAGTGGAGAAAGACC AACCAGAAAGTTCGCCTGAAGATCCGGGAGGCGGACAGCCCCGAGGGCCCCCAGCATTCT CCACTGGCAGCTGGACTCCTGAAGAAGGTGGCAGAGGAGACACCAGTATGA |
Restriction Sites | Please inquire |
ACCN | NM_001005416 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001005416.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001005416.1, NP_001005416.1 |
RefSeq Size | 1224 bp |
RefSeq ORF | 531 bp |
Locus ID | 51257 |
Cytogenetics | 19p13.2 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]). [supplied by OMIM, Mar 2010] Transcript Variant: This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 4. This variant encodes isoform 2, which is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218646 | MARCH2 (Myc-DDK-tagged)-Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3 |
USD 420.00 |
|
RG218646 | 41335 (GFP-tagged) - Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3 |
USD 460.00 |
|
RC218646L3 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC218646L4 | Lenti ORF clone of Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review