SIAH Interacting Protein (CACYBP) (NM_001007214) Human Untagged Clone

CAT#: SC301165

CACYBP (untagged)-Human calcyclin binding protein (CACYBP), transcript variant 2


  "NM_001007214" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACYBP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CACYBP
Synonyms GIG5; PNAS-107; S100A6BP; SIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001007214, the custom clone sequence may differ by one or more nucleotides


ATGCAACAGAAATCACAGAAGAAAGCAGAACTTCTTGATAATGAAAAACCAGCTGCTGTGGTTGCTCCCA
TTACAACGGGCTATACGGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTA
CATTACCTTAACTGGAGTTCATCAAGTTCCCACTGAGAATGTGCAGGTGCATTTCACAGAGAGGTCATTT
GATCTTTTGGTAAAGAATCTAAATGGGAAGAGTTACTCCATGATTGTGAACAATCTCTTGAAACCCATCT
CTGTGGAAGGCAGTTCAAAAAAAGTCAAGACTGATACAGTTCTTATATTGTGTAGAAAGAAAGTGGAAAA
CACAAGGTGGGATTACCTGACCCAGGTTGAAAAGGAGTGCAAAGAAAAAGAGAAGCCCTCCTATGACACT
GAAACAGATCCTAGTGAGGGATTGATGAATGTTCTAAAGAAAATTTATGAAGATGGAGACGATGATATGA
AGCGAACCATTAATAAAGCCTGGGTGGAATCAAGAGAGAAGCAAGCCAAAGGAGACACGGAATTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001007214
ORF Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001007214.1, NP_001007215.1
RefSeq Size 2875
RefSeq ORF 558
Locus ID 27101
Protein Pathways Wnt signaling pathway
Gene Summary The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an alternate 5' exon, and uses a downstream AUG start codon, as compared to variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.