SIAH Interacting Protein (CACYBP) (NM_001007214) Human Untagged Clone
CAT#: SC301165
CACYBP (untagged)-Human calcyclin binding protein (CACYBP), transcript variant 2
"NM_001007214" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CACYBP |
Synonyms | GIG5; PNAS-107; S100A6BP; SIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007214, the custom clone sequence may differ by one or more nucleotides
ATGCAACAGAAATCACAGAAGAAAGCAGAACTTCTTGATAATGAAAAACCAGCTGCTGTGGTTGCTCCCA TTACAACGGGCTATACGGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTA CATTACCTTAACTGGAGTTCATCAAGTTCCCACTGAGAATGTGCAGGTGCATTTCACAGAGAGGTCATTT GATCTTTTGGTAAAGAATCTAAATGGGAAGAGTTACTCCATGATTGTGAACAATCTCTTGAAACCCATCT CTGTGGAAGGCAGTTCAAAAAAAGTCAAGACTGATACAGTTCTTATATTGTGTAGAAAGAAAGTGGAAAA CACAAGGTGGGATTACCTGACCCAGGTTGAAAAGGAGTGCAAAGAAAAAGAGAAGCCCTCCTATGACACT GAAACAGATCCTAGTGAGGGATTGATGAATGTTCTAAAGAAAATTTATGAAGATGGAGACGATGATATGA AGCGAACCATTAATAAAGCCTGGGTGGAATCAAGAGAGAAGCAAGCCAAAGGAGACACGGAATTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007214 |
ORF Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001007214.1, NP_001007215.1 |
RefSeq Size | 2875 |
RefSeq ORF | 558 |
Locus ID | 27101 |
Protein Pathways | Wnt signaling pathway |
Gene Summary | The protein encoded by this gene is a calcyclin binding protein. It may be involved in calcium-dependent ubiquitination and subsequent proteosomal degradation of target proteins. It probably serves as a molecular bridge in ubiquitin E3 complexes and participates in the ubiquitin-mediated degradation of beta-catenin. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an alternate 5' exon, and uses a downstream AUG start codon, as compared to variant 1. The encoded isoform 2 has a shorter N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209815 | CACYBP (Myc-DDK-tagged)-Human calcyclin binding protein (CACYBP), transcript variant 2 |
USD 98.00 |
|
RG209815 | CACYBP (GFP-tagged) - Human calcyclin binding protein (CACYBP), transcript variant 2 |
USD 460.00 |
|
RC209815L3 | Lenti ORF clone of Human calcyclin binding protein (CACYBP), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC209815L4 | Lenti ORF clone of Human calcyclin binding protein (CACYBP), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review