DUSP13 (NM_001007273) Human Untagged Clone
CAT#: SC301206
DUSP13 (untagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 3
"NM_001007273" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DUSP13 |
Synonyms | BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007273, the custom clone sequence may differ by one or more nucleotides
ATGGGGCTCTGCCACTTTGCCACCCTGGCACTGATCCTGCTGGTGCTGCTGGAGGCTCTGGCCCAGGCGG ACACACAGAAGATGGTGGAAGCCCAGCGTGGGGTCGGCCCTAGAGCCTGCTACTCCATCTGGCTCCTCCT GGCGCCTACACCCCCTCTCAGCCACTGTCTTCAGTCTCCACAGAAACAGCATCAAGTGTGCGGAGACAGG CGGCTGAAAGCCAGCAGCACGAACTGCCCGTCAGAGAAGTGCACAGCCTGGGCCAGATACTCCCACAGGA TGGACTCACTGCAGAAGCAGGACCTCCGGAGGCCCAAGATCCATGGGGCAGTCCAGGCATCTCCCTACCA GCCGCCCACATTGGCTTCGCTGCAGCGCTTGCTGTGGGTCCGTCAGGCTGCCACACTGAACCATATCGAT GAGGTCTGGCCCAGCCTCTTCCTGGGAGATGCGTACGCAGCCCGGGACAAGAGCAAGCTGATCCAGCTGG GAATCACCCACGTTGTGAATGCCGCTGCAGGCAAGTTCCAGGTGGACACAGGTGCCAAATTCTACCGTGG AATGTCCCTGGAGTACTATGGCATCGAGGCGGACGACAACCCCTTCTTCGACCTCAGTGTCTACTTTCTG CCTGTTGCTCGATACATCCGAGCTGCCCTCAGTGTTCCCCAAGGCCGCGTGCTGGTACACTGTGCCATGG GGGTAAGCCGCTCTGCCACACTTGTCCTGGCCTTCCTCATGATCTGTGAGAACATGACGCTGGTAGAGGC CATCCAGACGGTGCAGGCCCACCGCAATATCTGCCCTAACTCAGGCTTCCTCCGGCAGCTCCAGGTTCTG GACAACCGACTGGGGCGGGAGACGGGGCGGTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007273 |
ORF Size | 876 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001007273.1, NP_001007274.1 |
RefSeq Size | 1362 |
RefSeq ORF | 876 |
Locus ID | 51207 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In mouse, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks several internal exons, compared to variant 1, resulting in a distinct protein (isoform 3, also called TMDP-L1), compared to isoform 1. Efforts to detect expression of isoform 3 were unsuccessful. Both variants 3 and 7 encode the same isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218373 | DUSP13 (Myc-DDK-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 3 |
USD 420.00 |
|
RG218373 | DUSP13 (GFP-tagged) - Human dual specificity phosphatase 13 (DUSP13), transcript variant 3 |
USD 460.00 |
|
RC218373L3 | Lenti-ORF clone of DUSP13 (Myc-DDK-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 3 |
USD 620.00 |
|
RC218373L4 | Lenti-ORF clone of DUSP13 (mGFP-tagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review