TRPM3 (NM_001007470) Human Untagged Clone
CAT#: SC301217
TRPM3 (untagged)-Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 8
"NM_001007470" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TRPM3 |
Synonyms | GON-2; LTRPC3; MLSN2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001007470, the custom clone sequence may differ by one or more nucleotides
ATGTATGTGCGAGTATCTTTTGATACAAAACCTGATCTCCTCTTACACCTGATGACCAAG GAATGGCAGTTGGAGCTTCCCAAGCTTCTCATCTCTGTCCATGGGGGCCTGCAGAACTTT GAACTCCAGCCAAAACTCAAGCAAGTCTTTGGGAAAGGGCTCATCAAAGCAGCAATGACA ACTGGAGCGTGGATATTCACTGGAGGGGTTAACACAGGTGTTATTCGTCATGTTGGCGAT GCCTTGAAGGATCATGCCTCTAAGTCTCGAGGAAAGATATGCACCATAGGTATTGCCCCC TGGGGAATTGTGGAAAACCAGGAGGACCTCATTGGAAGAGATGTTGTCCGGCCATACCAG ACCATGTCCAATCCCATGAGCAAGCTCACTGTTCTCAACAGCATGCATTCCCACTTCATT CTGGCTGACAACGGGACCACTGGAAAATATGGAGCAGAGGTGAAACTTCGAAGACAACTG GAAAAGCATATTTCACTCCAGAAGATAAACACAAGATGCCTGCCGTTTTTCTCTCTTGAC TCCCGCTTGTTTTATTCATTTTGGGGTAGTTGCCAGTTAGACTCAGTTGGAATCGGTCAA GGTGTTCCTGTGGTGGCACTCATAGTGGAAGGAGGACCCAATGTGATCTCGATTGTTTTG GAGTACCTTCGAGACACCCCTCCCGTGCCAGTGGTTGTCTGTGATGGGAGTGGACGGGCA TCGGACATCCTGGCCTTTGGGCATAAATACTCAGAAGAAGGCGGGTAG |
Restriction Sites | Please inquire |
ACCN | NM_001007470 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007470.1, NP_001007471.1 |
RefSeq Size | 1378 bp |
RefSeq ORF | 768 bp |
Locus ID | 80036 |
Cytogenetics | 9q21.12-q21.13 |
Protein Families | Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane |
Gene Summary | The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) contains a distinct 3' UTR and has an additional segment in the coding region, compared to variant 1. The resulting isoform (c) is shorter, and has a shorter C-terminus when compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213931 | TRPM3 (Myc-DDK-tagged)-Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 8 |
USD 420.00 |
|
RG213931 | TRPM3 (GFP-tagged) - Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 8 |
USD 460.00 |
|
RC213931L3 | Lenti-ORF clone of TRPM3 (Myc-DDK-tagged)-Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 8 |
USD 620.00 |
|
RC213931L4 | Lenti-ORF clone of TRPM3 (mGFP-tagged)-Human transient receptor potential cation channel, subfamily M, member 3 (TRPM3), transcript variant 8 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review