MAGEA11 (NM_001011544) Human Untagged Clone

CAT#: SC301572

MAGEA11 (untagged)-Human melanoma antigen family A, 11 (MAGEA11), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAGEA11
• Synonyms: CT1.11; MAGE-11; MAGE11; MAGEA-11
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001011544, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCAAGGTGAGCACTATGTTCTCAGAGGACGACTTCCAGTCAACAGAAAGAGCCCCATATGGTCCAC
  AACTACAGTGGTCCCAGGATCTGCCAAGAGTCCAGGTTTTTAGAGAACAGGCCAACCTGGAGGACAGGAG
  TCCCAGGAGAACCCAGAGGATCACTGGAGGAGAACAAGTGCTGTGGGGCCCCATCACCCAGATATTTCCC
  ACAGTTCGGCCTGCTGACCTAACCAGAGTCATCATGCCTCTTGAGCAAAGAAGTCAGCACTGCAAGCCTG
  AGGAAGGCCTTCAGGCCCAAGAAGAAGACCTGGGCCTGGTGGGTGCACAGGCTCTCCAAGCTGAGGAGCA
  GGAGGCTGCCTTCTTCTCCTCTACTCTGAATGTGGGCACTCTAGAGGAGTTGCCTGCTGCTGAGTCACCA
  AGTCCTCCCCAGAGTCCTCAGGAAGAGTCCTTCTCTCCCACTGCCATGGATGCCATCTTTGGGAGCCTAT
  CTGATGAGGGCTCTGGCAGCCAAGAAAAGGAGGGGCCAAGTACCTCGCCTGACCTGATAGACCCTGAGTC
  CTTTTCCCAAGATATACTACATGACAAGATAATTGATTTGGTTCATTTATTGCTCCGCAAGTATCGAGTC
  AAGGGGCTGATCACAAAGGCAGAAATGCTGGGGAGTGTCATCAAAAATTATGAGGACTACTTTCCTGAGA
  TATTTAGGGAAGCCTCTGTATGCATGCAACTGCTCTTTGGCATTGATGTGAAGGAAGTGGACCCCACTAG
  CCACTCCTATGTCCTTGTCACCTCCCTCAACCTCTCTTATGATGGCATACAGTGTAATGAGCAGAGCATG
  CCCAAGTCTGGCCTCCTGATAATAGTCCTGGGTGTAATCTTCATGGAGGGGAACTGCATCCCTGAAGAGG
  TTATGTGGGAAGTCCTGAGCATTATGGGGGTGTATGCTGGAAGGGAGCACTTCCTCTTTGGGGAGCCCAA
  GAGGCTCCTTACCCAAAATTGGGTGCAGGAAAAGTACCTGGTGTACCGGCAGGTGCCCGGCACTGATCCT
  GCATGCTATGAGTTCCTGTGGGGTCCAAGGGCCCACGCTGAGACCAGCAAGATGAAAGTTCTTGAGTACA
  TAGCCAATGCCAATGGGAGGGATCCCACTTCTTACCCATCCCTGTATGAAGATGCTTTGAGAGAGGAGGG
  AGAGGGAGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001011544
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001011544.1, NP_001011544.1
• RefSeq Size: 1893 bp
• RefSeq ORF: 1203 bp
• Locus ID: 4110
• Cytogenetics: Xq28
• Gene Summary: 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR and CDS compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a.