Destrin (DSTN) (NM_001011546) Human Untagged Clone

CAT#: SC301574

DSTN (untagged)-Human destrin (actin depolymerizing factor) (DSTN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DSTN
• Synonyms: ACTDP; ADF; bA462D18.2; HEL32
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001011546, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAGTTCGTAAATGCTCCACACCAGAAGAAATCAAGAAAAGAAAGAAGGCTGTCATTTTTTGTCTCA
  GTGCAGACAAAAAGTGCATCATTGTAGAAGAAGGCAAAGAGATCTTGGTTGGAGATGTTGGTGTAACCAT
  AACTGATCCTTTCAAGCATTTTGTGGGAATGCTTCCTGAAAAAGATTGTCGCTATGCTTTGTATGATGCA
  AGCTTTGAAACAAAAGAATCCAGAAAAGAAGAGTTGATGTTTTTTTTGTGGGCACCAGAACTAGCACCTC
  TGAAAAGTAAAATGATCTATGCAAGCTCCAAGGATGCAATTAAAAAGAAATTTCAAGGCATAAAACATGA
  ATGTCAAGCAAATGGACCAGAAGATCTCAATCGGGCTTGTATTGCTGAAAAGTTAGGTGGATCCTTAATT
  GTAGCCTTTGAAGGATGCCCTGTGTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001011546
• ORF Size: 447 bp
• Insert Size: 900
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001011546.1.

Reference Data

• RefSeq: NM_001011546.1, NP_001011546.1
• RefSeq Size: 1746
• RefSeq ORF: 447
• Locus ID: 11034
• Gene Summary: The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) contains an additional segment in the coding region compared to variant 1. This difference causes translation initiation at a downstream ATG and an isoform (b) with a shorter N-terminus compared to an isoform a.