GNRHR (NM_001012763) Human Untagged Clone

CAT#: SC301728

GNRHR (untagged)-Human gonadotropin-releasing hormone receptor (GNRHR), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNRHR
• Synonyms: GNRHR1; GRHR; HH7; LHRHR; LRHR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001012763, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAAACAGTGCCTCTCCTGAACAGAATCAAAATCACTGTTCAGCCATCAACAACAGCATCCCACTGA
  TGCAGGGCAACCTCCCCACTCTGACCTTGTCTGGAAAGATCCGAGTGACGGTTACTTTCTTCCTTTTTCT
  GCTCTCTGCGACCTTTAATGCTTCTTTCTTGTTGAAACTTCAGAAGTGGACACAGAAGAAAGAGAAAGGG
  AAAAAGCTCTCAAGAATGAAGCTGCTCTTAAAACATCTGACCTTAGCCAACCTGTTGGAGACTCTGATTG
  TCATGCCACTGGATGGGATGTGGAACATTACAGTCCAATGGTATGCTGGAGAGTTACTCTGCAAAGTTCT
  CAGTTATCTAAAGCTTTTCTCCATGTATGCCCCAGCCTTCATGATGGTGGTGATCAGCCTGGACCGCTCC
  CTGGCTATCACGAGGCCCCTAGCTTTGAAAAGCAACAGCAAAGTCGGACAGTCCATGGTTGGCCTGGCCT
  GGATCCTCAGTAGTGTCTTTGCAGGACCACAGCTGCCTCTTCATCATCCCTCTTTTCATCATGCTGATCT
  GCAATGCAAAAATCATCTTCACCCTGACACGGGTCCTTCATCAGGACCCCCACGAACTACAACTGAATCA
  GTCCAAGAACAATATACCAAGAGCACGGCTGAAGACTCTAAAAATGACGGTTGCATTTGCCACTTCATTT
  ACTGTCTGCTGGACTCCCTACTATGTCCTAGGAATTTGGTATTGGTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001012763
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001012763.1, NP_001012781.1
• RefSeq Size: 5715 bp
• RefSeq ORF: 750 bp
• Locus ID: 2798
• Cytogenetics: 4q13.2
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: GnRH signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: 'This gene encodes the receptor for type 1 gonadotropin-releasing hormone. This receptor is a member of the seven-transmembrane, G-protein coupled receptor (GPCR) family. It is expressed on the surface of pituitary gonadotrope cells as well as lymphocytes, breast, ovary, and prostate. Following binding of gonadotropin-releasing hormone, the receptor associates with G-proteins that activate a phosphatidylinositol-calcium second messenger system. Activation of the receptor ultimately causes the release of gonadotropic luteinizing hormone (LH) and follicle stimulating hormone (FSH). Defects in this gene are a cause of hypogonadotropic hypogonadism (HH). Alternative splicing results in multiple transcript variants encoding different isoforms. More than 18 transcription initiation sites in the 5' region and multiple polyA signals in the 3' region have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) uses an alternate splice site in the coding region, compared to variant 1, that results in a frameshift. It encodes isoform 2 which has a shorter and distinct C-terminus compared to isoform 1. Isoform 2 may act as an inhibitor of gonadotropin-releasing hormone receptor signaling.