LRRC67 (PPP1R42) (NM_001013626) Human Untagged Clone

CAT#: SC301801

PPP1R42 (untagged)-Human leucine rich repeat containing 67 (LRRC67)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R42
• Synonyms: dtr; LRRC67; TLLR; TLRR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001013626, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTTCGACTGACCTTGGATCTAATTGCCAGAAACAGCAATCTTAAACCCCGAAAAGAAGAAACCATTT
  CACAGTGCCTGAAGAAAATAACTCATATAAATTTTTCAGACAAAAATATAGATGCAATTGAAGACCTCTC
  TCTTTGCAAAAATCTTAGTGTTTTATATTTATATGATAATTGTATTAGTCAAATCACTAACCTGAATTAT
  GCCACAAATCTGACCCACTTGTACCTACAAAACAATTGTATTTCATGTATAGAGAACCTCAGGTCATTAA
  AGAAACTGGAAAAACTGTATCTGGGAGGCAATTACATTGCTGTCATAGAAGGTTTAGAAGGATTAGGAGA
  ACTAAGAGAGCTTCATGTTGAGAATCAGAGGCTTCCCCTTGGGGAAAAGCTTCTGTTTGATCCAAGAACT
  CTTCATTCTCTGGCAAAATCCCTCTGTATATTGAATATCAGCAATAATAATATTGATGACATTACAGACT
  TAGAACTACTAGAGAATCTTAATCAGCTCATAGCCGTTGACAACCAACTTCTGCATGTGAAGGATTTGGA
  GTTTTTACTGAACAAGTTGATGAAGCTGTGGAAAATTGATCTAAATGGAAATCCTGTTTGTCTCAAACCA
  AAATACAGGGACAGACTGATATTGGTGTCCAAATCACTGGGTACATATTTATATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001013626
• ORF Size: 687 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001013626.2, NP_001013648.1
• RefSeq Size: 1111
• RefSeq ORF: 687
• Locus ID: 286187
• Gene Summary: The protein encoded by this gene can interact with gamma-tubulin and PP1 phosphatase, a regulator of centrosome separation. The encoded protein is a positive regulator of PP1 phosphatase and thus plays a role in the control of centrosome integrity. [provided by RefSeq, Feb 2017]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).