DDX19B (NM_001014449) Human Untagged Clone

CAT#: SC301947

DDX19B (untagged)-Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DDX19B
• Synonyms: DBP5; DDX19; RNAh
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001014449, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTTTCAATCGTCCATCCAAGATACAAGAGAACGCATTGCCACTGATGCTTGCTGAGCCCCCACAGA
  ACTTAATTGCCCAATCTCAGTCTGGTACTGGTAAAACAGCTGCCTTCGTGCTGGCCATGCTTAGCCAAGT
  AGAACCTGCAAACAAATACCCCCAGTGTCTATGTCTCTCCCCAACGTATGAGCTCGCCCTCCAAACAGGA
  AAAGTGATTGAACAAATGGGCAAATTTTACCCTGAACTGAAGCTAGCTTATGCTGTTCGAGGCAATAAAT
  TGGAAAGAGGCCAGAAGATCAGTGAGCAGATTGTCATTGGCACCCCTGGGACTGTGCTGGACTGGTGCTC
  CAAGCTCAAGTTCATTGATCCCAAGAAAATCAAGGTGTTTGTTCTGGATGAGGCTGATGTCATGATAGCC
  ACTCAGGGCCACCAAGATCAGAGCATCCGCATCCAGAGGATGCTGCCCAGGAACTGCCAGATGCTGCTTT
  TCTCCGCCACCTTTGAAGACTCTGTGTGGAAGTTTGCCCAGAAAGTGGTCCCAGACCCAAACGTTATCAA
  ACTGAAGCGTGAGGAAGAGACCCTGGACACCATCAAGCAGTACTATGTCCTGTGCAGCAGCAGAGACGAG
  AAGTTCCAGGCCTTGTGTAACCTCTACGGGGCCATCACCATTGCTCAAGCCATGATCTTCTGCCATACTC
  GCAAAACAGCTAGTTGGCTGGCAGCAGAGCTCTCAAAAGAAGGCCACCAGGTGGCTCTGCTGAGTGGGGA
  GATGATGGTGGAACAGAGGGCTGCAGTGATTGAGCGCTTCCGAGAGGGCAAAGAGAAGGTTTTGGTGACC
  ACCAACGTGTGTGCCCGCGGCATTGATGTTGAACAAGTGTCTGTCGTCATCAACTTTGATCTTCCCGTGG
  ACAAGGACGGGAATCCTGACAATGAGACCTACCTGCACCGGATCGGGCGCACGGGCCGCTTTGGCAAGAG
  GGGCCTGGCAGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTGAACAGAATCCAGGAGCATTTT
  AATAAGAAGATAGAAAGATTGGACACAGATGATTTGGACGAGATTGAGAAAATAGCCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001014449
• ORF Size: 1113 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001014449.2, NP_001014449.1
• RefSeq Size: 1726
• RefSeq ORF: 1113
• Locus ID: 11269
• Gene Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks 2 consecutive exons in the 5' region, as compared to variant 1. This results in translation initiation from a downstream AUG codon and an isoform (3) with a shorter N-terminus compared to isoform 1.