DDX19B (NM_001014449) Human Untagged Clone
CAT#: SC301947
DDX19B (untagged)-Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3
"NM_001014449" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DDX19B |
Synonyms | DBP5; DDX19; RNAh |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001014449, the custom clone sequence may differ by one or more nucleotides
ATGGGTTTCAATCGTCCATCCAAGATACAAGAGAACGCATTGCCACTGATGCTTGCTGAGCCCCCACAGA ACTTAATTGCCCAATCTCAGTCTGGTACTGGTAAAACAGCTGCCTTCGTGCTGGCCATGCTTAGCCAAGT AGAACCTGCAAACAAATACCCCCAGTGTCTATGTCTCTCCCCAACGTATGAGCTCGCCCTCCAAACAGGA AAAGTGATTGAACAAATGGGCAAATTTTACCCTGAACTGAAGCTAGCTTATGCTGTTCGAGGCAATAAAT TGGAAAGAGGCCAGAAGATCAGTGAGCAGATTGTCATTGGCACCCCTGGGACTGTGCTGGACTGGTGCTC CAAGCTCAAGTTCATTGATCCCAAGAAAATCAAGGTGTTTGTTCTGGATGAGGCTGATGTCATGATAGCC ACTCAGGGCCACCAAGATCAGAGCATCCGCATCCAGAGGATGCTGCCCAGGAACTGCCAGATGCTGCTTT TCTCCGCCACCTTTGAAGACTCTGTGTGGAAGTTTGCCCAGAAAGTGGTCCCAGACCCAAACGTTATCAA ACTGAAGCGTGAGGAAGAGACCCTGGACACCATCAAGCAGTACTATGTCCTGTGCAGCAGCAGAGACGAG AAGTTCCAGGCCTTGTGTAACCTCTACGGGGCCATCACCATTGCTCAAGCCATGATCTTCTGCCATACTC GCAAAACAGCTAGTTGGCTGGCAGCAGAGCTCTCAAAAGAAGGCCACCAGGTGGCTCTGCTGAGTGGGGA GATGATGGTGGAACAGAGGGCTGCAGTGATTGAGCGCTTCCGAGAGGGCAAAGAGAAGGTTTTGGTGACC ACCAACGTGTGTGCCCGCGGCATTGATGTTGAACAAGTGTCTGTCGTCATCAACTTTGATCTTCCCGTGG ACAAGGACGGGAATCCTGACAATGAGACCTACCTGCACCGGATCGGGCGCACGGGCCGCTTTGGCAAGAG GGGCCTGGCAGTGAACATGGTGGACAGCAAGCACAGCATGAACATCCTGAACAGAATCCAGGAGCATTTT AATAAGAAGATAGAAAGATTGGACACAGATGATTTGGACGAGATTGAGAAAATAGCCAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001014449 |
ORF Size | 1113 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001014449.2, NP_001014449.1 |
RefSeq Size | 1726 |
RefSeq ORF | 1113 |
Locus ID | 11269 |
Gene Summary | DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks 2 consecutive exons in the 5' region, as compared to variant 1. This results in translation initiation from a downstream AUG codon and an isoform (3) with a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203416 | DDX19B (Myc-DDK-tagged)-Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3 |
USD 420.00 |
|
RG203416 | DDX19B (GFP-tagged) - Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3 |
USD 460.00 |
|
RC203416L3 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC203416L4 | Lenti ORF clone of Human DEAD (Asp-Glu-Ala-As) box polypeptide 19B (DDX19B), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review