FANCA (NM_001018112) Human Untagged Clone

CAT#: SC302190

FANCA (untagged)-Human Fanconi anemia, complementation group A (FANCA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FANCA
• Synonyms: FA; FA-H; FA1; FAA; FACA; FAH; FANCH
• Vector: pCMV6-XL6
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001018112 edited
  ATGTCCGACTCGTGGGTCCCGAACTCCGCCTCGGGCCAGGACCCAGGGGGCCGCCGGAGG
  GCCTGGGCCGAGCTGCTGGCGGGAAGGGTCAAGAGGGAAAAATATAATCCTGAAAGGGCA
  CAGAAATTAAAGGAATCAGCTGTGCGCCTCCTGCGAAGCCATCAGGACCTGAATGCCCTT
  TTGCTTGAGGTAGAAGGTCCACTGTGTAAAAAATTGTCTCTCAGCAAAGTGATTGACTGT
  GACAGTTCTGAGGCCTATGCTAATCATTCTAGTTCATTTATAGGCTCTGCTTTGCAGGAT
  CAAGCCTCAAGGCTGGGGGTTCCCGTGGGTATTCTCTCAGCCGGGATGGTTGCCTCTAGC
  GTGGGACAGATCTGCACGGCTCCAGCGGAGACCAGTCACCCTGTGCTGCTGACTGTGGAG
  CAGAGAAAGAAGCTGTCTTCCCTGTTAGAGTTTGCTCAGTATTTATTGGCACACAGTATG
  TTCTCCCGTCTTTCCTTCTGTCAAGAATTATGGAAAATACAGAGTTCTTTGTTGCTTGAA
  GCGGTGTGGCATCTTCACGTACAAGGCATTGTGAGCCTGCAAGAGCTGCTGGAAAGCCAT
  CCCGACATGCATGCTGTGGGATCGTGGCTCTTCAGGAATCTGTGCTGCCTTTGTGAACAG
  ATGGAAGCATCCTGCCAGCATGCTGACGTCGCCAGGGCCATGCTTTCTGATTTTGTTCAA
  ATGTTTGTTTTGAGGGGATTTCAGAAAAACTCAGATCTGAGAAGAACTGTGGAGCCTGAA
  AAAATGCCGCAGGTCGCGGTTGATGTACTGCAGAGAATGCTGATTTTTGCACTTGACGCT
  TTGGCTGCTGGAGTACAGGAGGAGTCCTCCACTCACAAGATCGTGAGGTGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001018112
• Insert Size: 1800 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001018112.1, NP_001018122.1
• RefSeq Size: 1673 bp
• RefSeq ORF: 894 bp
• Locus ID: 2175
• Cytogenetics: 16q24.3
• Protein Families: Druggable Genome
• Gene Summary: 'The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) contains an alternate exon, which results in an early stop codon, compared to variant 1. The resulting protein (isoform b) has a shorter C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.