APPBP1 (NAE1) (NM_001018159) Human Untagged Clone
CAT#: SC302200
NAE1 (untagged)-Human NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant 2
"NM_001018159" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NAE1 |
Synonyms | A-116A10.1; APPBP1; HPP1; ula-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001018159, the custom clone sequence may differ by one or more nucleotides
ATGGATGCTCAGCAAACAAAAACAAATGAAGCCAGGTTGTGGGGTGATCATGGGCAAGAGGCTTTAGAAT CTGCTCATGTTTGCCTAATAAATGCAACAGCCACAGGAACTGAAATTCTTAAAAACTTGGTACTACCAGG TATTGGTTCGTTTACAATTATTGATGGAAATCAGGTCAGCGGAGAAGATGCTGGAAACAATTTCTTCCTT CAAAGAAGCAGTATCGGCAAGAACCGAGCTGAAGCTGCCATGGAATTCTTACAAGAATTAAATAGCGATG TCTCTGGAAGTTTTGTGGAAGAGAGTCCAGAAAACCTTCTAGACAATGATCCCTCATTTTTCTGTAGGTT TACTGTTGTAGTTGCAACTCAGCTTCCTGAAAGCACTTCACTACGCTTAGCAGATGTCCTCTGGAATTCC CAGATTCCTCTTTTGATCTGTAGGACATATGGACTAGTTGGTTATATGAGGATCATTATAAAAGAACATC CAGTAATAGAATCTCATCCAGATAATGCATTAGAGGATCTACGACTAGATAAGCCATTTCCTGAACTGAG AGAACATTTTCAGTCCTATGATTTGGATCATATGGAAAAAAAGGACCACAGTCATACTCCATGGATTGTG ATCATAGCTAAATATTTAGCACAGTGGTATAGTGAAACAAATGGACGAATACCTAAAACGTATAAAGAAA AAGAGGACTTCAGAGATTTGATTAGACAAGGAATTCTAAAAAATGAAAATGGGGCTCCAGAAGATGAAGA GAATTTTGAAGAAGCTATTAAAAATGTGAACACAGCACTAAATACAACTCAGATCCCAAGCAGTATTGAA GATATATTTAATGATGATCGCTGCATAAATATCACCAAACAGACTCCATCATTTTGGATTTTAGCTCGTG CCTTAAAGGAATTTGTGGCCAAAGAGGGTCAAGGAAATTTACCTGTTCGAGGCACAATTCCTGATATGAT TGCAGATTCAGGCAAATATATAAAACTGCAAAACGTTTACCGTGAAAAAGCAAAGAAAGATGCTGCCGCT GTGGGTAATCATGTTGCCAAATTGCTGCAGTCCATTGGCCAGGCACCAGAGTCCATTTCAGAGAAAGAAT TAAAATTACTCTGCAGCAATTCTGCATTTCTTCGAGTGGTAAGATGTCGATCCTTAGCTGAAGAATATGG TTTGGATACAATTAACAAGGATGAAATTATTTCTAGCATGGACAATCCAGATAATGAAATAGTGTTGTAC TTAATGTTACGGGCTGTTGATAGATTTCATAAACAACAGGGTAGATATCCAGGAGTATCTAACTATCAAG TTGAAGAAGATATAGGAAAGTTGAAGTCTTGTCTCACTGGCTTCCTTCAGGAATATGGTTTATCTGTAAT GGTGAAAGATGATTATGTCCACGAATTTTGCCGATATGGAGCTGCTGAGCCACATACCATTGCTGCATTC TTGGGGGGAGCTGCTGCTCAAGAGGTCATCAAAATAATCACCAAACAATTTGTAATTTTTAATAATACTT ACATTTACAGTGGCATGTCACAAACTTCAGCAACTTTCCAGTTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001018159 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001018159.1, NP_001018169.1 |
RefSeq Size | 1918 bp |
RefSeq ORF | 1587 bp |
Locus ID | 8883 |
Cytogenetics | 16q22.1 |
Protein Pathways | Alzheimer's disease |
Gene Summary | The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221596 | NAE1 (Myc-DDK-tagged)-Human NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant 2 |
USD 480.00 |
|
RG221596 | NAE1 (GFP-tagged) - Human NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant 2 |
USD 530.00 |
|
RC221596L3 | Lenti-ORF clone of NAE1 (Myc-DDK-tagged)-Human NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant 2 |
USD 680.00 |
|
RC221596L4 | Lenti-ORF clone of NAE1 (mGFP-tagged)-Human NEDD8 activating enzyme E1 subunit 1 (NAE1), transcript variant 2 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review