U2AF35 (U2AF1) (NM_001025203) Human Untagged Clone
CAT#: SC302367
U2AF1 (untagged)-Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b
"NM_001025203" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | U2AF1 |
Synonyms | FP793; RN; RNU2AF1; U2AF35; U2AFBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001025203, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGTATCTGGCCTCCATCTTCGGCACCGAGAAAGACAAAGTCAACTGTTCATTTTATTTCAAAA TTGGAGCATGTCGTCATGGAGACAGGTGCTCTCGGTTGCACAATAAACCGACGTTTAGCCAGACCATCTT GATTCAAAACATCTATCGTAATCCCCAAAACAGTGCACAGACGGCTGACGGCTCACACTGTGCCGTGAGC GATGTGGAGATGCAGGAACACTATGATGAGTTTTTTGAGGAGGTTTTTACAGAAATGGAGGAGAAGTATG GGGAAGTAGAGGAGATGAACGTCTGTGACAACCTGGGAGACCACCTGGTGGGGAACGTGTACGTCAAGTT TCGCCGTGAGGAAGATGCGGAAAAGGCTGTGATTGACTTGAATAACCGTTGGTTTAATGGACAGCCGATC CACGCCGAGCTGTCACCCGTGACGGACTTCAGAGAAGCCTGCTGCCGTCAGTATGAGATGGGAGAATGCA CACGAGGCGGCTTCTGCAACTTCATGCATTTGAAGCCCATTTCCAGAGAGCTGCGGCGGGAGCTGTATGG CCGCCGTCGCAAGAAGCATAGATCAAGATCCCGATCCCGGGAGCGTCGTTCTCGGTCTAGAGACCGTGGT CGTGGCGGTGGCGGTGGCGGTGGTGGAGGTGGCGGCGGACGGGAGCGTGACAGGAGGCGGTCGAGAGATC GTGAAAGATCTGGGCGATTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025203 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001025203.1, NP_001020374.1 |
RefSeq Size | 971 bp |
RefSeq ORF | 723 bp |
Locus ID | 7307 |
Cytogenetics | 21q22.3 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | Spliceosome |
Gene Summary | 'This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (b) lacks an in-frame segment of the coding region, compared to variant c. The resulting isoform (b) has a longer N-terminus when compared to isoform c. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221772 | U2AF1 (Myc-DDK-tagged)-Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b |
USD 420.00 |
|
RG221772 | U2AF1 (GFP-tagged) - Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b |
USD 460.00 |
|
RC221772L3 | Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b, Myc-DDK-tagged |
USD 620.00 |
|
RC221772L4 | Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1 (U2AF1), transcript variant b, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review