TSPAN4 (NM_001025239) Human Untagged Clone

CAT#: SC302378

TSPAN4 (untagged)-Human tetraspanin 4 (TSPAN4), transcript variant 7


  "NM_001025239" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TSPAN4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSPAN4
Synonyms NAG-2; NAG2; TETRASPAN; TM4SF7; TSPAN-4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001025239, the custom clone sequence may differ by one or more nucleotides


ATGGCCATCGGCTTCGTGGGCTGCCTGGGTGCCATCAAGGAGAACAAGTGCCTCCTGCTCACTTTCTTCC
TGCTGCTGCTGCTGGTGTTCCTGCTGGAGGCCACCATCGCCATCCTCTTCTTCGCCTACACGGACAAGAT
TGACAGGTATGCCCAGCAAGACCTGAAGAAAGGCTTGCACCTGTACGGCACGCAGGGCAACGTGGGCCTC
ACCAACGCCTGGAGCATCATCCAGACCGACTTCCGCTGCTGTGGCGTCTCCAACTACACTGACTGGTTCG
AGGTGTACAACGCCACGCGGGTACCTGACTCCTGCTGCTTGGAGTTCAGTGAGAGCTGTGGGCTGCACGC
CCCCGGCACCTGGTGGAAGGCGCCGTGCTACGAGACGGTGAAGGTGTGGCTTCAGGAGAACCTGCTGGCT
GTGGGCATCTTTGGGCTGTGCACGGCGCTGGTGCAGATCCTGGGCCTGACCTTCGCCATGACCATGTACT
GCCAAGTGGTCAAGGCAGACACCTACTGCGCGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001025239
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025239.1, NP_001020410.1
RefSeq Size 1349 bp
RefSeq ORF 525 bp
Locus ID 7106
Cytogenetics 11p15.5
Protein Families Transmembrane
Gene Summary 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (7) lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (b) has a shorter N-terminus when compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.