DNAAF4 (NM_001033559) Human Untagged Clone
CAT#: SC302728
DYX1C1 (untagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2
"NM_001033559" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DNAAF4 |
Synonyms | CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001033559, the custom clone sequence may differ by one or more nucleotides
ATGCCTCTTCAGGTTAGCGATTACAGCTGGCAGCAGACGAAGACTGCGGTCTTTCTGTCTCTGCCCCTCA AAGGCGTGTGCGTCAGAGACACGGACGTGTTCTGCACGGAAAACTATCTGAAGGTCAACTTTCCTCCATT TTTATTTGAGGCATTTCTTTATGCTCCCATAGACGATGAGAGCAGCAAAGCAAAGATTGGGAATGACACC ATTGTCTTCACCTTGTATAAAAAAGAAGCGGCCATGTGGGAGACCCTTTCTGTGACGGGTGTTGACAAAG AGATGATGCAAAGAATTAGAGAAAAATCTATTTTACAAGCACAAGAGAGAGCAAAAGAAGCTACAGAAGC AAAAGCTGCAGCAAAGCGGGAAGATCAAAAATACGCACTAAGTGTCATGATGAAGATTGAAGAAGAAGAG AGGAAAAAAATAGAAGATATGAAAGAAAATGAACGGATAAAAGCCACTAAAGCATTGGAAGCCTGGAAAG AATATCAAAGAAAAGCTGAGGAGCAAAAAAAAATTCAGAGAGAAGAGAAATTATGTCAAAAAGAAAAGCA AATTAAAGAAGAAAGAAAAAAAATAAAATATAAGAGTCTTACTAGAAATTTGGCATCTAGAAATCTTGCT CCAAAAGGGAGAAATTCAGAAAATATATTTACTGAGAAGTTAAAGGAAGACAGTATTCCTGCTCCTCGCT CTGTTGGCAGTATTAAAATCAACTTTACCCCTCGAGTATTCCCAACAGCTCTTCGTGAATCACAAGTAGC AGAAGAGGAGGAGTGGCTACACAAACAAGCTGAGGCACGAAGAGCAATGAATACTGACATAGCTGAACTT TGCGATTTAAAAGAAGAAGAAAAGAACCCAGAATGGTTGAAGGATAAAGGAAACAAATTGTTTGCAACGG AAAACTATTTGGCAGCTATCAATGCATATAATTTAGCCATAAGACTAAATAATAAGATGCCACTATTGTA TTTGAACCGGGCTGCTTGCCACCTAAAACTAAAAAACTTACACAAGGCTATTGAAGATTCTTCTAAGGCC TACAGGATTATGAAGCGGCACTTAAGATTGATCCATCCAACAAAATTGTACAAATTGATGCTGAGAAGAT TCGGAATGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033559 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033559.2, NP_001028731.1 |
RefSeq Size | 1905 bp |
RefSeq ORF | 1131 bp |
Locus ID | 161582 |
Cytogenetics | 15q21.3 |
Gene Summary | This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) lacks an alternate exon that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct and shorter C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214248 | DYX1C1 (Myc-DDK-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2 |
USD 420.00 |
|
RG214248 | DYX1C1 (GFP-tagged) - Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2 |
USD 460.00 |
|
RC214248L3 | Lenti ORF clone of Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC214248L4 | Lenti ORF clone of Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review