BOLA3 (NM_001035505) Human Untagged Clone

CAT#: SC302834

BOLA3 (untagged)-Human bolA homolog 3 (E. coli) (BOLA3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BOLA3
• Synonyms: MMDS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001035505, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCATGGAGCCCGGCCGCGGCAGCGCCTCTCCTCCGCGGGATCCGCGGGCTTCCACTTCACCATC
  GGATGTTTGCCACTCAGACTGAGGGGGAGCTCAGAGTGACCCAAATTCTCAAAGAAAAGTTTCCACGAGC
  TACAGCTATAAAAGTCACTGACATTTCAGGCACTAAAAGAAGAAATCAAAGAGATGCATGGATTGCGGAT
  ATTTACCTCTGTCCCCAAACGCTGACCACGCCCTGGCTGCATAGATGCTGCTGCTTAAGACCTTGGATGA
  ACTTCACTGACATCATTCTTCCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001035505
• ORF Size: 306 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001035505.1, NP_001030582.1
• RefSeq Size: 465
• RefSeq ORF: 306
• Locus ID: 388962
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) lacks an internal coding exon compared to variant 1. This results in a frame-shift and a shorter isoform (2) with a distinct C-terminus compared to isoform 1. This isoform is localized to the cytoplasm (PMID:21944046). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.