Dermokine (DMKN) (NM_001035516) Human Untagged Clone

CAT#: SC302840

DMKN (untagged)-Human dermokine (DMKN), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DMKN
• Synonyms: UNQ729; ZD52F10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001035516, the custom clone sequence may differ by one or more nucleotides
  ATGAACATGAAGCCGGCCACTGCCTCTGCTCTGCTCCTGCTCCTGCTGGGCCTGGCCTGG
  ACCCAGGGGAGCCACGGCTGGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGA
  GCCGATCAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTAC
  TCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAA
  CCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001035516
• ORF Size: 273 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001035516.1, NP_001030593.1
• RefSeq Size: 607
• RefSeq ORF: 273
• Locus ID: 93099
• Gene Summary: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (1) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The encoded isoform (1, also referred to as isoform alpha) has a distinct N-terminus and is shorter than isoform 2.