PAR6 (PARD6A) (NM_001037281) Human Untagged Clone

CAT#: SC302873

PARD6A (untagged)-Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2


  "NM_001037281" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PARD6A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PARD6A
Synonyms PAR-6A; PAR6; PAR6alpha; PAR6C; TAX40; TIP-40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001037281, the custom clone sequence may differ by one or more nucleotides


ATGGCCCGGCCGCAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACG
CCGAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGGTTGCTGCG
GGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCTCATGGCGACCTGCTGCCC
CTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGGCCCCCGCCACTGCGCCTACTGGTGCAGA
AGCGGGAAGCTGACTCCAGCGGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTT
GCTGCGGCCAGTGGCACCCCTGCGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAG
GTTTCCTCAGTCATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTT
CAGACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGCCTGGAGCG
GGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGTACAGGGCTGCTGGCGGTC
AGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGGAAGACCTTGGACCAAGTGACGGACATGA
TGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGG
GGCATCTGGGCGTTTGACAGGTCCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGAC
AGCAGTGACCTGGTCATTGAGAACCGCCAGCCTCCCAGTTCCAATGGGCTGTCTCAGGGGCCCCCGTGCT
GGGACCTGCACCCTGGCTGCCGACATCCTGGTACCCGCAGCTCTCTGCCCTCCCTGGATGACCAGGAGCA
GGCCAGTTCTGGCTGGGGGAGTCGCATTCGAGGAGATGGTAGTGGCTTCAGCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001037281
ORF Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001037281.1, NP_001032358.1
RefSeq Size 1270
RefSeq ORF 1038
Locus ID 50855
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Endocytosis, Tight junction
Gene Summary This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a protein (isoform 2) that is one amino acid shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.