PAR6 (PARD6A) (NM_001037281) Human Untagged Clone
CAT#: SC302873
PARD6A (untagged)-Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2
"NM_001037281" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PARD6A |
Synonyms | PAR-6A; PAR6; PAR6alpha; PAR6C; TAX40; TIP-40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001037281, the custom clone sequence may differ by one or more nucleotides
ATGGCCCGGCCGCAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACG CCGAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGGTTGCTGCG GGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCTCATGGCGACCTGCTGCCC CTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGGCCCCCGCCACTGCGCCTACTGGTGCAGA AGCGGGAAGCTGACTCCAGCGGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTT GCTGCGGCCAGTGGCACCCCTGCGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAG GTTTCCTCAGTCATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTT CAGACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGCCTGGAGCG GGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGTACAGGGCTGCTGGCGGTC AGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGGAAGACCTTGGACCAAGTGACGGACATGA TGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGG GGCATCTGGGCGTTTGACAGGTCCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGAC AGCAGTGACCTGGTCATTGAGAACCGCCAGCCTCCCAGTTCCAATGGGCTGTCTCAGGGGCCCCCGTGCT GGGACCTGCACCCTGGCTGCCGACATCCTGGTACCCGCAGCTCTCTGCCCTCCCTGGATGACCAGGAGCA GGCCAGTTCTGGCTGGGGGAGTCGCATTCGAGGAGATGGTAGTGGCTTCAGCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037281 |
ORF Size | 1038 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001037281.1, NP_001032358.1 |
RefSeq Size | 1270 |
RefSeq ORF | 1038 |
Locus ID | 50855 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Endocytosis, Tight junction |
Gene Summary | This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a protein (isoform 2) that is one amino acid shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204843 | PARD6A (Myc-DDK-tagged)-Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2 |
USD 420.00 |
|
RG204843 | PARD6A (GFP-tagged) - Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2 |
USD 460.00 |
|
RC204843L1 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC204843L2 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC204843L3 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC204843L4 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review