HIST1H4I (NM_003495) Human Untagged Clone
CAT#: SC303319
HIST1H4I (untagged)-Human histone cluster 1, H4i (HIST1H4I)
"NM_003495" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HIST1H4I |
Synonyms | H4/m; H4FM; H4M |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003495, the custom clone sequence may differ by one or more nucleotides
ATGTCAGGACGCGGCAAAGGAGGTAAGGGCCTGGGGAAAGGGGGTGCCAAGCGCCACCGCAAGGTGCTGC GCGACAACATCCAGGGTATCACCAAGCCAGCCATTCGGCGCCTTGCTCGCCGCGGCGGCGTGAAGCGCAT TTCTGGCCTCATCTATGAGGAGACCCGCGGAGTGTTGAAGGTGTTCCTGGAGAACGTGATCCGGGACGCC GTGACCTACACGGAGCACGCCAAGCGCAAGACGGTCACCGCCATGGACGTGGTCTACGCGCTCAAGCGCC AGGGCCGCACCCTCTATGGCTTCGGCGGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_003495 |
ORF Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_003495.2, NP_003486.1 |
RefSeq Size | 370 |
RefSeq ORF | 312 |
Locus ID | 8294 |
Protein Pathways | Systemic lupus erythematosus |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC320923 | HIST1H4I (untagged)-Human histone cluster 1, H4i (HIST1H4I) |
USD 420.00 |
|
RC205044 | HIST1H4I (Myc-DDK-tagged)-Human histone cluster 1, H4i (HIST1H4I) |
USD 98.00 |
|
RG205044 | HIST1H4I (GFP-tagged) - Human histone cluster 1, H4i (HIST1H4I) |
USD 460.00 |
|
RC205044L3 | Lenti ORF clone of Human histone cluster 1, H4i (HIST1H4I), Myc-DDK-tagged |
USD 620.00 |
|
RC205044L4 | Lenti ORF clone of Human histone cluster 1, H4i (HIST1H4I), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review