Rapsyn (RAPSN) (NM_005055) Human Untagged Clone

CAT#: SC303569

RAPSN (untagged)-Human receptor-associated protein of the synapse (RAPSN), transcript variant 1


  "NM_005055" in other vectors (6)

Reconstitution Protocol

USD 700.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAPSN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAPSN
Synonyms CMS4C; CMS11; FADS; FADS2; RAPSYN; RNF205
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005055 edited
ATGGGGCAGGACCAGACCAAGAAGCAGATCGAGAAGGGGCTCCAGCTGTACCAGTCCAAC
CAGACAGAGAAGGCATTGCAGGTGTGGACAAAGGTGCTGGAGAAGAGCTCGGACCTCATG
GGGCGCTTCCGCGTGCTGGGCTGCCTGGTCACAGCCCACTCGGAGATGGGCCGCTACAAG
GAGATGCTGAAGTTCGCTGTGGTCCAGATCGACACGGCCCGGGAGCTGGAGGATGCCGAC
TTCCTCCTGGAGAGCTACCTGAACCTGGCACGCAGCAACGAGAAGCTGTGCGAGTTTCAC
AAGACCATCTCCTACTGCAAGACCTGCCTTGGGCTGCCTGGTACCAGGGCAGGTGCCCAG
CTCGGAGGCCAGGTCAGCCTGAGCATGGGCAATGCCTTCCTGGGCCTCAGCGTCTTCCAG
AAGGCCCTGGAGAGCTTCGAGAAGGCCCTGCGCTATGCCCACAACAATGATGACGCCATG
CTCGAGTGCCGCGTGTGCTGCAGCCTGGGCAGCTTCTATGCCCAGGTCAAGGACTACGAG
AAAGCCCTGTTCTTCCCCTGCAAGGCGGCAGAGCTTGTCAACAACTATGGCAAAGGCTGG
AGCCTGAAGTACCGGGCCATGAGCCAGTACCACATGGCCGTGGCCTATCGCCTGCTGGGC
CGCCTGGGCAGTGCCATGGAGTGTTGTGAGGAGTCTATGAAGATCGCGCTGCAGCACGGG
GACCGGCCACTGCAGGCGCTCTGCCTGCTCTGCTTCGCTGACATCCACCGGAGCCGTGGG
GACCTGGAGACAGCCTTCCCCAGGTACGACTCCGCCATGAGCATCATGACCGAGATCGGA
AACCGCCTGGGGCAGGTGCAGGCGCTGCTGGGTGTGGCCAAGTGCTGGGTGGCCAGGAAG
GCGCTGGACAAGGCTCTGGATGCCATCGAGAGAGCCCAGGATCTGGCCGAGGAGGTGGGG
AACAAGCTGAGCCAGCTCAAGCTGCACTGTCTGAGCGAGAGCATTTACCGCAGCAAAGGG
CTGCAGCGGGAACTGCGGGCGCACGTTGTGAGGTTCCACGAGTGCGTGGAGGAGACGGAG
CTCTACTGCGGCCTGTGCGGCGAGTCCATAGGCGAGAAGAACAGCCGGCTGCAGGCCCTA
CCTTGCTCCCACATCTTCCACCTCAGGTGCCTGCAGAACAACGGGACCCGGAGCTGTCCC
AACTGCCGCCGCTCATCCATGAAGCCTGGCTTTGTATGA
Restriction Sites Please inquire     
ACCN NM_005055
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone was fully sequenced and its ORF matches with NM_005055.3. There is a SNP in the ORF.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005055.3, NP_005046.2
RefSeq Size 1664 bp
RefSeq ORF 1239 bp
Locus ID 5913
Cytogenetics 11p11.2
Protein Families Druggable Genome
Gene Summary 'This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]'
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.