Histone H1.3 (HIST1H1D) (NM_005320) Human Untagged Clone

CAT#: SC303615

HIST1H1D (untagged)-Human histone cluster 1, H1d (HIST1H1D)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HIST1H1D
• Synonyms: H1.3; H1D; H1F3; H1s-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005320, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGAGACTGCTCCACTTGCTCCTACCATTCCTGCACCCGCAGAAAAAACACCTGTGAAGAAAAAGG
  CGAAGAAGGCAGGCGCAACTGCTGGGAAACGCAAAGCATCCGGACCCCCAGTATCTGAGCTTATCACCAA
  GGCAGTGGCAGCTTCTAAGGAGCGCAGCGGCGTTTCTCTGGCCGCGCTTAAGAAAGCGCTTGCGGCTGCT
  GGCTACGATGTAGAAAAAAACAACAGCCGTATCAAGCTTGGCCTCAAGAGCTTGGTGAGCAAAGGTACTC
  TGGTGCAGACCAAAGGTACCGGTGCTTCTGGCTCCTTCAAACTCAACAAGAAAGCGGCTTCCGGGGAAGG
  CAAACCCAAGGCCAAAAAGGCTGGCGCAGCCAAGCCTAGGAAGCCTGCTGGGGCAGCCAAGAAGCCCAAG
  AAGGTGGCTGGCGCCGCTACCCCGAAGAAAAGCATCAAAAAGACTCCTAAGAAGGTAAAGAAGCCAGCAA
  CCGCTGCTGGGACCAAGAAAGTGGCCAAGAGTGCGAAAAAGGTGAAAACACCTCAGCCAAAAAAAGCTGC
  CAAGAGTCCAGCTAAGGCCAAAGCCCCTAAGCCCAAGGCGGCCAAGCCTAAGTCGGGGAAGCCGAAGGTT
  ACAAAGGCAAAGAAGGCAGCTCCGAAGAAAAAGTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_005320
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005320.2, NP_005311.1
• RefSeq Size: 777 bp
• RefSeq ORF: 666 bp
• Locus ID: 3007
• Cytogenetics: 6p22.2
• Gene Summary: 'Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Aug 2015]'