alpha Tubulin (TUBA3C) (NM_006001) Human Untagged Clone

CAT#: SC303718

TUBA3C (untagged)-Human tubulin, alpha 3c (TUBA3C)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TUBA3C
• Synonyms: bA408E5.3; TUBA2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_006001, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTGAGTGTATCTCTATCCACGTGGGGCAGGCAGGAGTCCAGATCGGCAATGCCTGCTGGGAACTGT
  ACTGCCTGGAACATGGAATTCAGCCCGATGGTCAGATGCCAAGTGATAAAACCATTGGTGGTGGGGACGA
  CTCCTTCAACACGTTCTTCAGTGAGACTGGAGCTGGCAAGCACGTGCCCAGAGCAGTGTTTGTGGACCTG
  GAGCCCACTGTGGTCGATGAAGTGCGCACAGGAACCTATAGGCAGCTCTTCCACCCAGAGCAGCTGATCA
  CCGGGAAGGAAGATGCGGCCAATAATTACGCCAGAGGCCATTACACCATCGGCAAGGAGATCGTCGACCT
  GGTCCTGGACCGGATCCGCAAACTGGCGGATCTGTGCACGGGACTGCAGGGCTTCCTCATCTTCCACAGT
  TTTGGGGGTGGCACTGGCTCTGGGTTCGCATCTCTGCTCATGGAGCGGCTCTCAGTGGATTACGGCAAGA
  AGTCCAAGCTAGAATTTGCCATTTACCCAGCCCCCCAGGTCTCCACGGCCGTGGTGGAGCCCTACAACTC
  CATCCTGACCACCCACACGACCCTGGAACATTCTGACTGTGCCTTCATGGTCGACAATGAAGCCATCTAT
  GACATATGTCGGCGCAACCTGGACATCGAGCGTCCCACGTACACCAACCTCAATCGCCTGATTGGGCAGA
  TCGTGTCCTCCATCACGGCCTCCCTGCGATTTGACGGGGCCCTGAATGTGGACTTGACGGAATTCCAGAC
  CAACCTAGTGCCGTACCCCCGCATCCACTTCCCCCTGGCCACCTACGCCCCGGTCATCTCAGCCGAGAAG
  GCCTACCACGAGCAGCTGTCCGTGGCTGAGATCACCAATGCCTGCTTCGAGCCAGCCAATCAGATGGTCA
  AGTGTGACCCTCGCCACGGCAAGTACATGGCCTGCTGCATGTTGTACAGGGGGGATGTGGTCCCGAAAGA
  TGTCAACGCGGCCATCGCCACCATCAAGACCAAGCGCACCATCCAGTTTGTAGATTGGTGCCCAACTGGA
  TTTAAGGTGGGCATTAACTACCAGCCCCCCACGGTGGTCCCTGGGGGAGACCTGGCCAAGGTGCAGCGGG
  CTGTGTGCATGCTGAGCAACACCACGGCCATCGCGGAGGCCTGGGCTCGCCTGGACCATAAGTTCGATCT
  CATGTATGCCAAGCGGGCCTTTGTGCACTGGTACGTGGGAGAAGGCATGGAGGAGGGGGAGTTCTCTGAG
  GCCCGCGAGGACCTGGCAGCTCTGGAGAAGGATTATGAAGAGGTGGGCGTGGATTCCGTGGAAGCCGAGG
  CTGAAGAAGGTGAAGAATACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_006001
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006001.2, NP_005992.1
• RefSeq Size: 1564 bp
• RefSeq ORF: 1353 bp
• Locus ID: 7278
• Cytogenetics: 13q12.11
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• Protein Pathways: Gap junction, Pathogenic Escherichia coli infection
• Gene Summary: 'Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene is an alpha tubulin gene that encodes a protein 99% identical to the mouse testis-specific Tuba3 and Tuba7 gene products. This gene is located in the 13q11 region, which is associated with the genetic diseases Clouston hidrotic ectodermal dysplasia and Kabuki syndrome. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) is the longest transcript and encodes the full-length isoform (1).