SPO11 (NM_012444) Human Untagged Clone
CAT#: SC303983
SPO11 (untagged)-Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1
"NM_012444" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPO11 |
Synonyms | CT35; SPATA43; TOPVIA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_012444, the custom clone sequence may differ by one or more nucleotides
ATGGCCTTTGCACCTATGGGGCCCGAGGCCTCGTTCTTCGACGTTTTGGACCGACACAGGGAGTCCCTGC TGGCTGCCCTGAGGAGAGGTGGCAGGGAGCCCCCAACTGGGGGAAGCCGCCTGGCCTCCAGTTCTGAGGT TCTTGCATCTATAGAAAATATTATCCAAGACATAATCACAAGCTTGGCAAGAAATGAAGCACCTGCATTC ACGATAGACAACAGATCAAGCTGGGAAAACATAAAGTTTGAAGATTCTGTGGGTCTTCAGATGGTATCCC ATTGCACCACCAGAAAGATCAAAAGTGATTCACCAAAATCAGCTCAAAAATTTTCTCTAATCCTTAAAAT ATTGTCCATGATTTATAAATTAGTACAGAGCAACACTTATGCAACCAAAAGGGACATATATTACACTGAC AGTCAACTCTTTGGTAACCAGACTGTCGTCGACAATATTATCAATGACATTTCTTGCATGTTAAAAGTGT CAAGGAGGAGTCTACATATATTATCTACATCAAAAGGTTTAATTGCTGGCAACTTAAGATACATCGAGGA AGATGGCACCAAAGTGAATTGTACCTGTGGTGCAACGGCTGTTGCTGTGCCATCGAATATTCAAGGAATT CGGAATTTAGTTACAGATGCAAAGTTTGTATTAATTGTAGAAAAAGATGCAACATTTCAGCGGCTCCTAG ATGACAACTTTTGCAACAAATTGTCTCCTTGCATCATGATTACGGGAAAGGGAGTTCCTGATCTAAACAC AAGACTTTTAGTCAAGAAACTGTGGGATACATTTCATGTTCCTGTTTTCACTCTTGTAGATGCTGATCCA CATGGCATAGAAATAATGTGCATCTATAAGTATGGATCTATGTCTATGTCTTTTGAAGCTCATCATCTCA CAGTTCCAGCTATTAGATGGCTTGGTCTTCTCCCTTCTGATCTTAAAAGATTAAATGTACCTAAAGATAG TTTGATTCCACTGACAAAAAGGGACCAAATGAAACTTGACAGTATCCTGAGGAGACCTTATGTTACCTGC CAACCATTTTGGAGAAAAGAAATGGAAATAATGGCAGACTCTAAAATGAAGGCAGAAATTCAAGCTTTGA CTTTCCTATCATCAGATTATCTTTCCAGAGTGTACTTACCTAACAAATTAAAATTTGGAGGATGGATATA A |
Restriction Sites | Please inquire |
ACCN | NM_012444 |
ORF Size | 1191 bp |
Insert Size | 1800 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_012444.2, NP_036576.1 |
RefSeq Size | 1826 |
RefSeq ORF | 1191 |
Locus ID | 23626 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221227 | SPO11 (Myc-DDK-tagged)-Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1 |
USD 420.00 |
|
RG221227 | SPO11 (GFP-tagged) - Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1 |
USD 460.00 |
|
RC221227L1 | Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC221227L2 | Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC221227L3 | Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC221227L4 | Lenti ORF clone of Human SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae) (SPO11), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review